Detected as a riboswitch by 15 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA058797 Similarity: 0.923 Similarity: 0.923 Similarity: 0.923
UTR: 5HSAA058797
Gene: LGMN
MFE: -90.141
ENS: 0.831
Length: 233.
Predicted Ligands:
cobalamin - 20/20 - 20/20


 RS: URS00023158FC_359391
MFE: -82.358
Ligand: cobalamin
Species: Brucella melitensis biovar Abortus 2308 Cobalamin riboswitch
 RS: URS00023191CA_1945860
MFE: -91.688
Ligand: cobalamin
Species: Rhodanobacter sp. B04 Cobalamin riboswitch
 RS: URS0000836DDC_543877
MFE: -91.304
Ligand: cobalamin
Species: Altererythrobacter marensis Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA058797 URS00023158FC_359391 URS00023191CA_1945860 URS0000836DDC_543877
Length 233. 232. 233. 235.
Similarity - 0.923 0.923 0.923
Ensemble Norm 0.831 - - -
MFE -90.141 -82.358 -91.688 -91.304
Ligands - cobalamin cobalamin cobalamin
Gene LGMN - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 20.001 12. 13.
Length SE - 1. 0. 4.
Lev Distance - 90. 97. 89.
UBS 17. 15. 17. 18.
BS 0. 1. 0. 1.
ILL 4. 3. 5. 5.
ILR 3. 4. 4. 3.
H 8. 8. 5. 5.
BL 5. 3. 6. 5.
BR 5. 2. 5. 6.
UN 0.069 0.099 0.090 0.072

Sequences

Field Description
UTR seq + 25 gcacaguggcccuuaagcgaggagcggcggcgcccgcagcaaucacagcagugccgacgucguggguguuuggugugaggcugcgagccgccgcgaguucucacggucccgccggcgccaccaccgcggucacucaccgccgccgccgccaccacugccaccacggucgccugccacaggugucugcaauugaacuccaaggugcagaATGGTTTGGAAAGTAGCTGTATTCC
UTR dot + 25 ((……))((((….)))).((((((((…((((((..(((((.(((.(((.((…)).)))..))).))))).)))))).))))))))……….(((..((.(((((……..(((((…..)))))))))).))..)))((((……))))((((((…))))))((((((.(((…..)))..))))))((((((……..))))))…..
RS 1 seq CCGUAAUACCGUCAUGACGGUUCCCCGACCGAGAGCGAAGGGGAUUAAUAGGGAACACGGUGAGGACGACCCAUCAAGGGGCCGAGACCGUGGCUGCCCCCGCAACUGUAAGCGGAUUGCCGUUCAUCCUCGUGACGCCGAAAGCGUCAUGCCACUGUGCCCACGGCACGGGAAGGCAGAUGGACGGCGAUUAUCCGCAAGCCAGGAGACCUGCCGUCUUACGUAGUCCAUU
RS 1 dot …….(((((….)))))(((((..((….).)..)))))……(((..((((((…..((.(((……))).))..))))))….)))((((……..))))(((((((((((((..((((((((…..))))))))((.(((((((…)))))))…))..)))))))))))))..(((……..)))((.((((……..))))))….
RS 2 seq CUAAAGUGGCGCGGUUCAGGUGUCCCGAAGGCUUAGCGCCGGAGGGAUGAAACGGGAAGCCGGUGCGUGGUGUUCGACAACACUGCAAGGCCGGCGCUGCCCCCGCAACGGUAAGCGAGAUCCACGUACGGCGAAUGCCACUGUGCCUGAGCACGGGAAGGCGCCGUUCGGGACAUGCGGAUCGCCGCAUGUCGCUCGCAAGCCCGGAGACCGGCCCGAACGAUUCCUGGUGG
RS 2 dot …..(((((((((((..(((((..((((.(((..(((((((……………..)))))))..))).))))…)))))….))))).))))))…(((……..)))…(((.((.(((((….(((.((((((….))))))…)))))))).)))))(((((((….)))))))(((.(((…(.((((…))))).))).)))……….
RS 3 seq GAACGUUAUCGCGUCGCAGGCAGGUCUCCUGGCUCGCGGGUCGUGACGGCAGCCCGGCCUUCCCAGCUUGGCAAGAUGCAAGCCAGUGGCGUUGUCGGGAUGCCGCUCGCCGCUCACAGUUGCGGGGGCAGCGCCGGACUUCAUUCGCACGGAAUGUCACCGGCUUCCCGUCUUAGCCCCGUGACGCAGCAAUUCGCACCGCCGCGCACGAGGAACCUCGACCCGCGCUACAAAG
RS 3 dot (.((((….)))))..((.((((…)))).))(((((((((((((((((.((((((….((((((((……..)))))…)))….)))))).))))).)))).(((…((..(((((((….(((((….(((((…..)))))…)))))))))))))).)))((((((.(((.((……….)).))))))).))……))))))))……..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table