Detected as a riboswitch by 5 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA058802 Similarity: 0.912 Similarity: 0.910 Similarity: 0.908
UTR: 5HSAA058802
Gene: LGMN_0
MFE: -101.503
ENS: 0.663
Length: 268.
Predicted Ligands:
cobalamin - 18/20
glucosamine - 2/20

 RS: URS000231219A_169427
MFE: -100.523
Ligand: cobalamin
Species: Burkholderia terricola Cobalamin riboswitch
 RS: URS0002323323_1851148
MFE: -87.263
Ligand: cobalamin
Species: Phycisphaerae bacterium SM-Chi-D1 Cobalamin riboswitch
 RS: URS0002328AE2_1004785
MFE: -70.589
Ligand: cobalamin
Species: Alteromonas macleodii str. 'Black Sea 11' Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA058802 URS000231219A_169427 URS0002323323_1851148 URS0002328AE2_1004785
Length 268. 269. 269. 266.
Similarity - 0.912 0.910 0.908
Ensemble Norm 0.663 - - -
MFE -101.503 -100.523 -87.263 -70.589
Ligands - cobalamin cobalamin cobalamin
Gene LGMN - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 25.001 15.002 22.
Length SE - 1. 1. 4.
Lev Distance - 104. 112. 106.
UBS 20. 21. 20. 17.
BS 0. 0. 0. 0.
ILL 5. 7. 6. 5.
ILR 5. 8. 5. 5.
H 8. 7. 5. 5.
BL 5. 2. 6. 5.
BR 6. 5. 8. 4.
UN 0.086 0.059 0.126 0.083

Sequences

Field Description
UTR seq + 25 agaugccacgccccauagcuccaccagucaccgcggcacaguggcccuuaagcgaggagcggcggcgcccgcagcaaucacagcagugccgacgucguggguguuuggugugaggcugcgagccgccgcgaguucucacggucccgccggcgccaccaccgcggucacucaccgccgccgccgccaccacugccaccacggucgccugccacaggugucugcaauugaacuccaaggugcagaATGGTTTGGAAAGTAGCTGTATTCC
UTR dot + 25 ….(((((((((….(((…..)))….).)))…)))))((((….)))).((((((((…((((((..(((((.(((.(((.((…)).)))..))).))))).)))))).))))))))……….(((..((.(((((……..(((((…..)))))))))).))..)))…(((…..)))((((((…))))))((((((.(((…..)))..))))))((((((……..))))))…..
RS 1 seq UACACUCGCACGCACUUUGGUGCUCGUGUGCGCGCUCCUGCGCAUGCAGUUAAACGGGAAACAGGGCGCCCGCCUUCAAGGACCGGGUCAACCUGUGCUGCCCCCGCAACGGUAAGCGAAAUGCGGUACGUCACGUACCGCGGAGCCGGCUUCGAUGUCCACGCGCAAGGCCGCGUCGGCAUACAACCACUGGGCGAGAAAUCACUCGCACGGGAAGGGGAAGCGGCGCUUUCGCCAGCCCGGAUACCGGCCAGAGCACGCAGGACGAA
RS 1 dot (((((..((((……..))))..)))))((((((..((((…(((((……….(((((..((((((((…)))..)))).)..))))))))))…))))..)))..)))…(((((((((…)))))))))…((((….((((((.(((((……))))).))))).)…..))))(((((……))))).((((..((((((((…)))))).))..))))….((.((……..)).))…..
RS 2 seq AAUUGAAUCAUGUCUCCAGGACAAGGCCGUUAUGGUCUUGCACGAGGGAACACGGUUAGAAUCCGUGGCGGACGCGCCGCUGUAUUCGCUUUCCGGUCUAAAUGAAACGUCAAUCAAUGCGAUUGACCAGUUCAGGCCGGCGAAUCGGGCGAGAAACCACUGUUGGCAACUUGUUUUAUUUGAUUAACUUAAACACAACAAGCUGCGAGCGGGAAGGUGCCCGAUAUUGAAGCGUAAGUCAGAAAACCUGCCUGAGACAGAAUACUUGU
RS 2 dot …..((((.((((((..(..(((((((…..)))))))..)..)))).)).)))).(((((.((((((….)))))).).))))…..((((((….((((..(((((((…..)))))))…))))))))))((((((((((…..(((.(((((.(((.((((((…(((((…..)))))…)))))).))).)))))…)))))))))).)))…….((.(((…..))).))…………….
RS 3 seq UAUAAUCGAUGGCGUGUAGGUGCUCUUGUCUAACGCCAUAUUAACUACGGUGACAAGGGUUAAACGGGAAAUCAGUGAAAAGCUGAUGCUGCCCCCGCAACGGUAAACUCAACGCAUUGUCGUUUUCUUUUCAUACGCCACUGUCUUUUAUACGUUUACGCGCGCUCCUGCGUAGCUAAACGCCAAUAGAUGGGAAGGCAAAAGAGCCAUUACAUACUUGGUAAUGGUGAGUAAGCCCGGAUACCGGCCUGUACUUCAUGGUGUCG
RS 3 dot ……..(((((((.((((……..)))))))))))…(((.((((((….(((((…((((..((((((…..))))))……))))……..)))))….)))))).)))(((((((…..(((.((((((……((((((.((((((….)))).))))))))…..))))))…))))))))))(((((((…….))))))).(((((((.((((…)))).)).)))))……….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table