Detected as a riboswitch by 1 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA058805 Similarity: 0.953 Similarity: 0.949 Similarity: 0.948
UTR: 5HSAA058805
Gene: LGMN_1
MFE: -53.405
ENS: 0.571
Length: 174.
Predicted Ligands:
cobalamin - 8/20
lysine - 7/20
FMN - 1/20
 RS: URS0000AE5668_1701573
MFE: -54.647
Ligand: cobalamin
Species: Paraburkholderia piptadeniae Cobalamin
 RS: URS0002331214_999898
MFE: -44.264
Ligand: cobalamin
Species: Desulfitobacterium sp. enrichment culture clone CEB3 Cobalamin riboswitch
 RS: URS0000ABC2F7_658086
MFE: -60.789
Ligand: lysine
Species: Lachnospiraceae bacterium 3_1_57FAA_CT1 Lysine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA058805 URS0000AE5668_1701573 URS0002331214_999898 URS0000ABC2F7_658086
Length 174. 173. 172. 175.
Similarity - 0.953 0.949 0.948
Ensemble Norm 0.571 - - -
MFE -53.405 -54.647 -44.264 -60.789
Ligands - cobalamin cobalamin lysine
Gene LGMN - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 10.002 14. 5.
Length SE - 1. 4. 1.
Lev Distance - 55. 54. 66.
UBS 17. 18. 16. 16.
BS 0. 0. 0. 0.
ILL 6. 5. 5. 5.
ILR 5. 3. 4. 4.
H 2. 2. 3. 2.
BL 9. 9. 6. 8.
BR 7. 9. 8. 8.
UN 0.086 0.046 0.087 0.097

Sequences

Field Description
UTR seq + 25 gucguggguguuuggugugaggcugcgagccgccgcgaguucucacggucccgccggcgccaccaccgcggucacucaccgccgccgccgccaccacugccaccacguuucccuucucaggugucugcaauugaacuccaaggugcagaATGGTTTGGAAAGTAGCTGTATTCC
UTR dot + 25 ..(((((..((..((((.(.(((.(((.((.((.(.((((..((.((((…((….))….)))).))..)))).).)).))))).))).)))))))..)))))(((((….(((….((((((.(((…..)))..)))))).)))…)))))………….
RS 1 seq AAUACCCGCUCGCCGGUGCCUUUCGGGGCCUAAGAGGGAACACGUCGUCGUGACUGCCCCCGCAACUGUAUGCAGCGAGUCCACGCCAUUUUGCGCCACUGGUAUCACCGGGAAGGCCGGCGUCGGACAGCGACCUGCUAGUCAGAAGACCUACCGGCCAACUGUUCGUGCCA
RS 1 dot …..((..((.((((((….(((((((.(((((.((….(((.(.(.((.((((….((….))..)))))).).).))))).))))).))).))))…)))))))).))..((((.(((((((….(((.(((((….))).)).)))….))))))))))).
RS 2 seq GUGAAUAUGCAUACUACAGGUGCCCUUAAGGGGAGAAUAGGAAACCGGGUGUAACCCCCGGACGGACCCGCCACUGUGAAGGGGAGCUGUUGCCAUAACCACUCCAAAAGGGGGAAGGGGCAAGUUAGCGAUGAACCUGAGUCAGGAGACCUGCCUGUAAUGAUCUAUACCG
RS 2 dot (((..((((((….((((.(.(((((.(.((..(………(((((…….)))))………)..)).).))))).).)))))).))))..)))(((……))).(.(((((.(((..((((……..))).)..))).))))).)…………..
RS 3 seq GAGAAUGAUAGAGGUGCGGGCUUUAUCAGUACCAGGCGGGCUAUGGAACAGGACAGCCGUCCGCCAGGGAAAGGAAAGGCCGCCGAAGAAGGGGUUCCCGGUCCGGGGAAUUUUUUCUGGGGCACAGCAGAAUAUGCGGUGCACUGUCACAAGGAUGUGGAGCGCUAUCUUGGAU
RS 3 dot ……………((((.((((.((….((.(((((((..((……..))…))))))).))….)))))).))))(.((((.((.(((((..((((..(((……..(((.((((.(((…..))).)))).))))).)..))))..))))).)).)))).)..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table