Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA058832 Similarity: 0.990 Similarity: 0.989 Similarity: 0.989
UTR: 5HSAA058832
Gene: LGSN
MFE: -12.710
ENS: 0.971
Length: 59.
Predicted Ligands:
unknown - 14/20
glutamine - 4/20
fluoride - 2/20
 RS: URS0000D68A55_12908
MFE: -19.088
Ligand: unknown
Species: unclassified sequences nhaA-I RNA
 RS: URS0000D67123_12908
MFE: -9.898
Ligand: glutamine
Species: unclassified sequences Glutamine riboswitch
 RS: URS0000E60730_1321778
MFE: -12.110
Ligand: unknown
Species: Clostridiales bacterium oral taxon 876 str. F0540 DUF1646 RNA
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA058832 URS0000D68A55_12908 URS0000D67123_12908 URS0000E60730_1321778
Length 59. 60. 59. 58.
Similarity - 0.990 0.989 0.989
Ensemble Norm 0.971 - - -
MFE -12.710 -19.088 -9.898 -12.110
Ligands - unknown glutamine unknown
Gene LGSN - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 2.001 2.005 7.
Length SE - 1. 0. 1.
Lev Distance - 12. 14. 12.
UBS 4. 3. 4. 3.
BS 0. 0. 0. 0.
ILL 0. 0. 0. 0.
ILR 0. 0. 1. 1.
H 2. 2. 2. 2.
BL 2. 1. 1. 0.
BR 1. 1. 1. 0.
UN 0.153 0.183 0.085 0.172

Sequences

Field Description
UTR seq + 25 gugguuucuaacgcugaacuuaaaaaguguugagATGAATAATGAAGAGGACCTTCTGC
UTR dot + 25 .(.(((((.((((((……….))))))))))).)…..((((…..))))…
RS 1 seq GGGUGUCUAAAUCUAUUUGACUCGAUUUAGACAGGUAUUAGUGUCGGUCGGGCCGCCGCA
RS 1 dot …((((((((((……….))))))))))…….(((.((((…)))).))).
RS 2 seq AUCGUUCAGCAAAAAGAAACAAUUUUUUGCCGAAAGUACGCCGACUGAAGGAACGGGAA
RS 2 dot ..(((((.(((((((……..))))))).))….)))(((……….)))…
RS 3 seq GGUUGGACAGACUUACUAAUAUCUGAUUCCAAGAAAUUUGUUUCUAGGGUGGGAAACU
RS 3 dot ..(((((((((……….))))..)))))…….((((((……)))))).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table