Detected as a riboswitch by 8 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA058889 Similarity: 0.973 Similarity: 0.971 Similarity: 0.971
UTR: 5HSAA058889
Gene: LHX3
MFE: -53.890
ENS: 0.863
Length: 122.
Predicted Ligands:
TPP - 7/20
preQ_1 - 3/20
FMN - 3/20
 RS: URS0000AB3EB5_617121
MFE: -27.561
Ligand: preQ_1
Species: Streptococcus dysgalactiae subsp. equisimilis RE378 preQ1-II (pre queuosine) riboswitch
 RS: URS0000AB8380_663952
MFE: -27.016
Ligand: preQ_1
Species: Streptococcus dysgalactiae subsp. dysgalactiae ATCC 27957 preQ1-II (pre queuosine) riboswitch
 RS: URS0000C42ECB_1519490
MFE: -45.436
Ligand: TPP
Species: Streptomyces sp. NRRL WC-3618 TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA058889 URS0000AB3EB5_617121 URS0000AB8380_663952 URS0000C42ECB_1519490
Length 122. 120. 120. 121.
Similarity - 0.973 0.971 0.971
Ensemble Norm 0.863 - - -
MFE -53.890 -27.561 -27.016 -45.436
Ligands - preQ_1 preQ_1 TPP
Gene LHX3 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 8.001 12. 9.005
Length SE - 4. 4. 1.
Lev Distance - 28. 29. 35.
UBS 8. 7. 7. 8.
BS 0. 0. 0. 0.
ILL 0. 1. 1. 1.
ILR 0. 1. 2. 2.
H 4. 4. 3. 4.
BL 2. 0. 0. 2.
BR 3. 2. 2. 1.
UN 0.221 0.250 0.242 0.149

Sequences

Field Description
UTR seq + 25 gccccgcacgacgcggcgggacuugggagccccgaacccuccaggggacgcugaccuaggaggagcgcgucucgcgccacucggccugguggccgcgATGACGCTTAACATGAAGGAGACCC
UTR dot + 25 ..(((((.((…)))))))..(((((…)))))..(((((.(((……..))).)))))…(((((((((((((((……)))))).)))).)))))………………
RS 1 seq UGUGGUACAAUGUAACCGUUGCUUAGCAACCCUUGGUGCUUAGUUCCCUUUCACCAAGCAUAUUAGACACGUAAAGAGUUAGGUUUGACUAACUGCUUUGACGUUAAAGGAGAAAAAAUG
RS 1 dot …(((……..)))(((((…))))).(((((((…((….))..)))))))……….((((((((((((((……)))))).))))).)))…………….
RS 2 seq UGUGGUACAAUGUAACCGUUGUUUAGCAACCCUUGGUGCUUAGUUCCCUUUCACCAAGCAUAUUAGACACGUAAAGAGUUAGGUUUGACUAACUGCUUUGACGUUAAAGGAGAAAAAAUG
RS 2 dot …(((((((((….))))))……)))(((((((…((….))..)))))))……….((((((((((((((……)))))).))))).)))…………….
RS 3 seq AUAUUCCGACAGGGGAGCGCCACAGCGCUGAGAGUGCGGCAGCCAGAUCACAUUGGUGGGCCGCAGACCCUCUGAACCUCGCCCAGGUCAUUCUGGGUAGGAAGUUCGGUCAUCACUCUUG
RS 3 dot …((((….))))(((((….)))))…..((((((.((((……..))))..))))))((((….((((.(((((((((….)))))))..)).))))))))……….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table