Detected as a riboswitch by 9 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA058897 Similarity: 0.983 Similarity: 0.983 Similarity: 0.983
UTR: 5HSAA058897
Gene: LIAS
MFE: -26.171
ENS: 0.868
Length: 98.
Predicted Ligands:
purine - 17/20
TPP - 2/20
tetrahydrofolate - 1/20
 RS: URS0000C6E6FF_1262961
MFE: -24.440
Ligand: purine
Species: Ruminococcus sp. CAG:563 Purine riboswitch
 RS: URS0000AB988A_272621
MFE: -14.939
Ligand: purine
Species: Lactobacillus acidophilus NCFM Purine riboswitch
 RS: URS0000C36DF4_1345695
MFE: -13.548
Ligand: purine
Species: Clostridium saccharobutylicum DSM 13864 Purine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA058897 URS0000C6E6FF_1262961 URS0000AB988A_272621 URS0000C36DF4_1345695
Length 98. 99. 98. 98.
Similarity - 0.983 0.983 0.983
Ensemble Norm 0.868 - - -
MFE -26.171 -24.440 -14.939 -13.548
Ligands - purine purine purine
Gene LIAS - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 2.009 3. 2.002
Length SE - 1. 0. 0.
Lev Distance - 21. 22. 23.
UBS 5. 5. 4. 4.
BS 0. 0. 0. 0.
ILL 1. 1. 1. 0.
ILR 1. 1. 2. 1.
H 2. 2. 2. 2.
BL 1. 0. 0. 1.
BR 0. 1. 0. 0.
UN 0.347 0.253 0.347 0.388

Sequences

Field Description
UTR seq + 25 guaauuucgaccuguccuuucccgggaguuagcgaucccucaaccccugcacugcgcuaguccuaaagaggaaATGTCTCTACGCTGCGGGGATGCAG
UTR dot + 25 …………………..((((……..))))…..(((((((..(((.(((((((….))))…….)))))))))))))……
RS 1 seq UACUAAGAAUAAUAUAUUGCCGAUAUAUUGCCGAAUGAAUGGCUCGGCAGUCUCUACGACAGUGCCGUAACUGUCACUAUUGGUGGAUGAUUGACAGCA
RS 1 dot ……………….((((……(((……..)))))))((((((((((((((((……))))))…….))))).)))))……
RS 2 seq GAUUAAGCCAAUACAAAUAUCUAUAUAUCGUCGAAAUAAGGUCGACAGUUUCUACCCACUACCGUAAAUGGUGGACUAUAGGUAAACGAAAUUAAGAA
RS 2 dot ………………………..(((((…….)))))((((((((((..(((((……)))))……))))…))))))…..
RS 3 seq AACAUAGCACAUUUAAAAACUCGUAUAUACCUUGAAUAUGGCAAGGAGUAUCUACCGGAGACCUUAAAUUUCCGACUAUGGGUGAUAUUAAUAUAAGC
RS 3 dot ………………………..(((((…….)))))((((((.((((((((…….)))))…….)))))))))………

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table