Detected as a riboswitch by 2 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA058898 Similarity: 0.970 Similarity: 0.967 Similarity: 0.966
UTR: 5HSAA058898
Gene: LIAS_0
MFE: -40.783
ENS: 0.765
Length: 143.
Predicted Ligands:
glucosamine - 14/20
cobalamin - 3/20
Ni/Co - 1/20
 RS: URS0000BF55B5_1133849
MFE: -52.919
Ligand: cobalamin
Species: Nocardia brasiliensis ATCC 700358 Cobalamin riboswitch
 RS: URS0000AB4FB8_862517
MFE: -37.426
Ligand: glucosamine
Species: Peptoniphilus duerdenii ATCC BAA-1640 glmS glucosamine-6-phosphate activated ribozyme
 RS: URS0000D9E819_1465756
MFE: -24.026
Ligand: glucosamine
Species: Peptoniphilus grossensis glmS glucosamine-6-phosphate activated ribozyme
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA058898 URS0000BF55B5_1133849 URS0000AB4FB8_862517 URS0000D9E819_1465756
Length 143. 143. 143. 143.
Similarity - 0.970 0.967 0.966
Ensemble Norm 0.765 - - -
MFE -40.783 -52.919 -37.426 -24.026
Ligands - cobalamin glucosamine glucosamine
Gene LIAS - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 5. 7.002 7.004
Length SE - 0. 0. 0.
Lev Distance - 38. 42. 43.
UBS 10. 10. 8. 9.
BS 0. 0. 0. 0.
ILL 2. 2. 3. 1.
ILR 3. 5. 3. 2.
H 4. 4. 3. 4.
BL 2. 2. 2. 2.
BR 0. 1. 1. 2.
UN 0.126 0.140 0.077 0.189

Sequences

Field Description
UTR seq + 25 agccaaucguggagcagcuuggcugcuugucauaaauggagcgacguaauuucgaccuguccuuucccgggaguuagcgaucccucaaccccugcacugcgcuaguccuaaagaggaaATGTCTCTACGCTGCGGGGATGCAG
UTR dot + 25 ..(((…((((((((((…)))))))..)))…)))((.((((………..))))))…..((((……..))))…..(((((((..(((.(((((((….))))…….)))))))))))))……
RS 1 seq AGAGGGAACCCGGUGGGAAUCCGGGACUGUCCCGCAGCGGUAAACAGGAACGAAUGCCGUCACGAGCACUGGGUACCCCAACCCGGAAAGCGACGGUUAGUAGGUCGGCCGACAACGGCCGGUGCCUGUGAGUCCGAAGACCU
RS 1 dot …((((.(((((…….)))))….))))…((((((..(……)..))))))…..((.((((((……))))))…))..(((((..(((((((((((….))))))..)))))..)).)))…….
RS 2 seq AAAAAUCUUGAAGCGCCAGAACCUUUUUGGUUGACGAGGAGUGAGAUCAUCGAAAAUUCGGCGGAUGUCUCAAAGGUACCACAGCCUAAGUGCCAUACAAAUAUGCGAGUAAUCGCAAAACAAAAUUGGCAAAGUGGGGCCGA
RS 2 dot …..(((((….(((((((…)))))))…)))))..(((((.((((…………)))))))))..(((.((((……..(((((……..(((((….)))))………)))))..)))).)))..
RS 3 seq AAAAUAAUUUAAGCGCCUGAGCCCAAGUGGCUGACGAGGGGUAGAGUUAUCGAAUAUCGGCGGAUGCUCUAAAGGUUUCACAGCCUAAACAUUUUACAAAAAAUAAAAGCAAUUUUAUAACAAAAUAGAUGUAGUGAGUCUCU
RS 3 dot ………….(.((((((((…..))))..).))).)(((((.((((………..))))))))).(((((….)))))..((((((……..((((((….))))))……..))))))………..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table