Detected as a riboswitch by 1 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA058926 Similarity: 0.967 Similarity: 0.965 Similarity: 0.965
UTR: 5HSAA058926
Gene: LIG3
MFE: -44.964
ENS: 0.793
Length: 133.
Predicted Ligands:
cobalamin - 6/20
TPP - 4/20
FMN - 4/20
 RS: URS0000C70D1D_40148
MFE: -46.090
Ligand: TPP
Species: Oryza glumipatula TPP riboswitch (THI element)
 RS: URS0000AB7534_12908
MFE: -25.794
Ligand: cobalamin
Species: unclassified sequences AdoCbl variant RNA
 RS: URS0000C394F0_1629719
MFE: -35.848
Ligand: FMN
Species: Clostridiaceae bacterium BRH_c20a FMN riboswitch (RFN element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA058926 URS0000C70D1D_40148 URS0000AB7534_12908 URS0000C394F0_1629719
Length 133. 134. 133. 135.
Similarity - 0.967 0.965 0.965
Ensemble Norm 0.793 - - -
MFE -44.964 -46.090 -25.794 -35.848
Ligands - TPP cobalamin FMN
Gene LIG3 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 7.004 6.014 13.019
Length SE - 1. 0. 4.
Lev Distance - 40. 45. 37.
UBS 8. 8. 8. 10.
BS 0. 0. 0. 0.
ILL 4. 2. 2. 5.
ILR 0. 1. 0. 2.
H 2. 2. 2. 2.
BL 2. 3. 1. 2.
BR 3. 2. 4. 5.
UN 0.233 0.172 0.113 0.096

Sequences

Field Description
UTR seq + 25 gacccggauuuaaagagacaggcgcuccaaccgucgugggcugcccgcggccuguaaugagcaaguuccgaggccuacggugagcgccggagccggagaggcagcuauATGTCTTTGGCTTTCAAGATCTTCT
UTR dot + 25 ………………..(((((((..(((((…(((((…((.(((.(((…..))).))).)).)))))))))))))))))(((((((..((((((……)))))))))))))………..
RS 1 seq AUAGUUGCACCGGGGUGCCUGUAUUCUCAACGAUCUGUAGGCCUCUUGGCCCGGAUUGUUGUGAGUUGGGCUGAGAAAGUCCCUUUGAACCUGAACAGGAUAAUGCCUGCGAAGGGAGUGUGCACUUCUAUUUU
RS 1 dot …………….(((((.((((.((((((((((..((((….)))))))))))))).)))))))))..(((((.((((((((……..((((……)))))))))))).)……))))…..
RS 2 seq AUACUGAAAUGCAUGGUGGGAAAUUAGUGUGUAAUUCACUUGCUGUACCUGCAACCGUAGAGUCGGAGCGCCACCCAGUAUAGACCCCUGUGGAAUUAAGGCCAGGAAAAGUUUUAAUUUUUACAAAUUUGCA
RS 2 dot ((((((……..(((((…………………((((.(((((((….)))).)).).)))))))))))))))…….((((((((((((((……..))))))))))).)))……..
RS 3 seq AUUUUUCUUCGGGGCAUGGUGAGAAAGCUAAGGCUUUCAAUUCCUGACCGGCGGUAUAGCCCGCGAGCCAUUUUUUUGGCAUGAACUGGUGUGAUUCCAGUGCCGACAGUAUAGUCUGGAUGGGAGAAGACGGAU
RS 3 dot ………(((..((((.((((((((….(((((…………..((((……))))))))).)))))))).))))..)))((.(..(((((…(((((……))).)).)))))..).))….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table