Detected as a riboswitch by 5 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA058928 Similarity: 0.974 Similarity: 0.973 Similarity: 0.973
UTR: 5HSAA058928
Gene: LIG3_0
MFE: -31.638
ENS: 0.835
Length: 115.
Predicted Ligands:
FMN - 6/20
methionine - 5/20
cobalamin - 3/20
 RS: URS0000C47F37_1127134
MFE: -46.094
Ligand: methionine
Species: Nocardia cyriacigeorgica GUH-2 S-adenosyl methionine (SAM) riboswitch,
 RS: URS0000BFE945_1736303
MFE: -36.571
Ligand: methionine
Species: Arthrobacter sp. Leaf234 S-adenosyl methionine (SAM) riboswitch,
 RS: URS0000BEC403_197221
MFE: -33.051
Ligand: glutamine
Species: Thermosynechococcus elongatus BP-1 Glutamine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA058928 URS0000C47F37_1127134 URS0000BFE945_1736303 URS0000BEC403_197221
Length 115. 115. 114. 113.
Similarity - 0.974 0.973 0.973
Ensemble Norm 0.835 - - -
MFE -31.638 -46.094 -36.571 -33.051
Ligands - methionine methionine glutamine
Gene LIG3 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 12.002 5. 3.
Length SE - 0. 1. 4.
Lev Distance - 31. 34. 31.
UBS 7. 9. 8. 7.
BS 0. 0. 0. 0.
ILL 2. 2. 3. 1.
ILR 1. 1. 0. 2.
H 2. 2. 2. 2.
BL 1. 3. 2. 2.
BR 2. 4. 1. 2.
UN 0.165 0.122 0.158 0.186

Sequences

Field Description
UTR seq + 25 gcucuaggacccggauuuaaagagacaggcgcuccaaccgucgugggcugcccgcggccuguaaugagcaaguuccgaggccuacgcuauATGTCTTTGGCTTTCAAGATCTTCT
UTR dot + 25 ….((((.(((((((((……((((((………..((((((…))))))))))))…….)))).))).)))))).((((……..))))…………..
RS 1 seq GGUCAUGAGUGCCAGCGUCAAGCCCCGGCUUGCUGGCCGGCAACCCUCCUCCGCGGUGGGGUGCUCCGGGUGACGACCUGGCGCGCAUCGAAGCCAGAUGCGGCAAGUGCGGAUU
RS 1 dot ..(((((.((((((((((((…(((((……….((((.(((.((…..)).))).))))))))))))))..))))))).))).)).(((……)))………..
RS 2 seq AAUCAAGAGUUCCAACGCAAAACCCUGGUUUGUUGGACGGCAACCCUCUCGCUGUAGCGGGGUGCCCCAGGUGAGGAUUCGGCCCGUCAUGCACCGUGCGGGCAAGUAUGGCGC
RS 2 dot ……((((((((………(((((……….(((.((((…(((….))))))))))))))))).)))))).(((((.((((…)))))))))………..
RS 3 seq AUCGUUCAUCCCUCGUAGGACCUCAGUAAACGCUUUUCAGACCGAGUUGAAGUGUCAGCGUUGUUCCUUUGCGAGGGACGGAAGUAGGGAAAUAAAUCCCGAAGGAACGCGCC
RS 3 dot ….(((.((((((((((((.(……((((((((((((……))))))….))))))).))))..)))))))).)))….((((……))))………….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table