Detected as a riboswitch by 2 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA059111 Similarity: 0.981 Similarity: 0.981 Similarity: 0.981
UTR: 5HSAA059111
Gene: LINGO1
MFE: -21.856
ENS: 0.669
Length: 77.
Predicted Ligands:
fluoride - 6/20
glycine - 5/20
cobalamin - 2/20
RS: URS0002315521_198822
MFE: -31.549
Ligand: cobalamin
Species: Candidatus Burkholderia kirkii Cobalamin riboswitch
RS: URS0000D685C4_12908
MFE: -25.469
Ligand: Ni/Co
Species: unclassified sequences NiCo riboswitch
RS: URS0000C2B97F_313367
MFE: -17.813
Ligand: glycine
Species: Jannaschia seosinensis Glycine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA059111 URS0002315521_198822 URS0000D685C4_12908 URS0000C2B97F_313367
Length 77. 79. 75. 76.
Similarity - 0.981 0.981 0.981
Ensemble Norm 0.669 - - -
MFE -21.856 -31.549 -25.469 -17.813
Ligands - cobalamin Ni/Co glycine
Gene LINGO1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 2.002 5.017 7.
Length SE - 4. 4. 1.
Lev Distance - 20. 19. 22.
UBS 8. 8. 7. 8.
BS 0. 0. 0. 0.
ILL 1. 1. 0. 2.
ILR 1. 1. 1. 2.
H 2. 2. 3. 2.
BL 5. 4. 4. 3.
BR 4. 3. 3. 3.
UN 0.169 0.127 0.040 0.184

Sequences

Field Description
UTR seq + 25 ggagagacaugcgauuggugaccgagccgagcggaccgaaggcgcgcccgagATGCTGGCGGGGGGCGTGAGGAGCA
UTR dot + 25 ………(.((.(((((……))))).)).)((..(.((.(.((((………))))).)).)..))….
RS 1 seq GGAAGCCGGUGCGAACCCGGCACGGUCGCGCCACUGUGAGCGGUUCGUCAGCGAAGGAGCGAGGCGCCGCAAGUCAGAC
RS 1 dot …….((((((.(((……))))))))).((((..(((((.(.((.((……)))).).)))))..).)))..
RS 2 seq ACAGUACAAGCUGAUCAGGCCGUAAAACCGGCCGGGCCUGACGGCAGGAGAUUAUCCUACAUCUGCGGGACAGGA
RS 2 dot .((((….)))).((.(((((……))))).))((((.(.(((((.(………).))))).)..)))).
RS 3 seq CGACGACACUCUGGAGAGACCCCGGACGGGGCGCCGAAGGGAUAGCGAUCUCAGGCCAAAGGACAGAGGGGGCAUU
RS 3 dot ……..((((((…(.((((….))))).))..))))…((..((((.(.((…)).).))))..))…

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table