Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA059119 Similarity: 0.976 Similarity: 0.972 Similarity: 0.972
UTR: 5HSAA059119
Gene: LINGO2
MFE: -22.394
ENS: 0.962
Length: 126.
Predicted Ligands:
TPP - 11/20
FMN - 7/20
cobalamin - 1/20
 RS: URS0000DAD61F_1801958
MFE: -39.802
Ligand: TPP
Species: Planctomycetes bacterium GWF2_42_9 TPP riboswitch (THI element)
 RS: URS0000C4B355_1262751
MFE: -34.743
Ligand: TPP
Species: Bacteroides sp. CAG:770 TPP riboswitch (THI element)
 RS: URS0000C519FF_1681197
MFE: -48.173
Ligand: TPP
Species: Arthrobacter sp. RIT-PI-e TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA059119 URS0000DAD61F_1801958 URS0000C4B355_1262751 URS0000C519FF_1681197
Length 126. 126. 125. 125.
Similarity - 0.976 0.972 0.972
Ensemble Norm 0.962 - - -
MFE -22.394 -39.802 -34.743 -48.173
Ligands - TPP TPP TPP
Gene LINGO2 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 5.014 3.001 2.021
Length SE - 0. 1. 1.
Lev Distance - 31. 35. 36.
UBS 8. 8. 8. 8.
BS 0. 0. 0. 0.
ILL 2. 3. 3. 1.
ILR 2. 2. 2. 2.
H 3. 3. 3. 3.
BL 2. 2. 1. 2.
BR 2. 0. 1. 3.
UN 0.135 0.254 0.168 0.280

Sequences

Field Description
UTR seq + 25 auugugaagauugaaugagaucguaagugaaauuugagaucauuaggaugaaaucaccucuaagagacccgugaccaagguguagacuaagaaguggagucATGCTTCACACGGCCATATCATGCT
UTR dot + 25 …((((……..(((((((.(((((…))))).)))).)))……..))))(((…)))..(((((….((((((.((((………))))))))))..)))))…………
RS 1 seq AAUUCGUGACAGGGGAGCCGGAUAAGGUAUUUGAGAUACCGAGUCUGGCUGAGAGGCCGAAUGUUCGGCGACCCUUCGAACCUUUAGCAGUGGUAAUGCCUGCAAGGGAGGCACUGGAAUUGAUCA
RS 1 dot ……………((((((((..((((((…))))))..))))))))..(..(((((….)))))..)(((…..(((((.((((.(……)))))))))))))……………
RS 2 seq CGAACAUCAAAGGGGUGCCGAUGCAUCAGGCCGUACCAAGACGGCGCAUGCGGGAAGAAGGCUGAGAUUAUACCCUCAAACCUGACGCAGACAAUGCUGCCGCAGGAAUUGAUCUCAAUGUUAUC
RS 2 dot ….((((…..))))(((((((…..(((((……))))))))).)))………(((((……..((((.((((..((((……))))..))))..)))))))))……..
RS 3 seq AACGAACGACAGGGGAGCGCCGAGCCGCGGUACACCGCGGACACGGGCGCUGAGAGUGCGGACCGCCGCAGACCCUCGAACCUGAUCCGGUUAGUACCGGCGAAGGGAGUCGAGUUCUCAGAGUG
RS 3 dot ……………(((((((.(((((((….)))))).).))).))))…..(((((….)))))….(((((.(((…(((((….)))))…)))…)))))………..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table