Detected as a riboswitch by 18 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA059278 Similarity: 0.979 Similarity: 0.978 Similarity: 0.978
UTR: 5HSAA059278
Gene: LLPH
MFE: -17.548
ENS: 0.939
Length: 81.
Predicted Ligands:
SAM - 6/20
zmp-ztp - 5/20
cobalamin - 4/20
 RS: URS0000C0F800_1315974
MFE: -31.056
Ligand: zmp-ztp
Species: Sphingobium sp. TKS ZMP/ZTP riboswitch
 RS: URS0000D7B00E_1977292
MFE: -27.410
Ligand: zmp-ztp
Species: Bacillus xerothermodurans ZMP/ZTP riboswitch
 RS: URS0000DB2089_883078
MFE: -25.590
Ligand: SAM
Species: Afipia broomeae ATCC 49717 SAM riboswitch (alpha-proteobacteria)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA059278 URS0000C0F800_1315974 URS0000D7B00E_1977292 URS0000DB2089_883078
Length 81. 80. 81. 80.
Similarity - 0.979 0.978 0.978
Ensemble Norm 0.939 - - -
MFE -17.548 -31.056 -27.410 -25.590
Ligands - zmp-ztp zmp-ztp SAM
Gene LLPH - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 8.007 3. 3.004
Length SE - 1. 0. 1.
Lev Distance - 24. 28. 27.
UBS 7. 8. 6. 7.
BS 0. 0. 0. 0.
ILL 1. 2. 1. 2.
ILR 2. 4. 2. 2.
H 3. 2. 2. 2.
BL 3. 3. 2. 2.
BR 2. 1. 2. 2.
UN 0.099 0.013 0.099 0.037

Sequences

Field Description
UTR seq + 25 aaagacuuccggucggcgugagcgugagguguggguguucguuucucagguaaaacATGGCTAAAAGCTTACGGAGTAAGT
UTR dot + 25 …((((…))))(.((((.((.(((((..(((….)))..))))).))….)))).)…..((((((…))))))
RS 1 seq CCGCGUUCGCGCGACUGGCGAUUGAGAUGGAGCACCAUCGGGAAGCGCGAGCGGUCGAGCCCCGCGCCUGGGCAAUCGGG
RS 1 dot .((((((((..((.((.(((.((..(((((….)))))..))..))).))))..)))))…)))(((((….)))))
RS 2 seq UUUGGUAUGUGGGAGUGGCGUAAACGUGGGCUGACCACGAGGACGCACAUAUUCAUACCGCCGUACGCCGGGGCAGAGGUA
RS 2 dot …(((.((((((.(((((((…(((((…..)))))…)))).))).))))))..)))….(((……..))).
RS 3 seq UAGCCAUUCUGUGGUCAUUUGAGCCGGCCGGCUUGCAGCCACGUUAAACAACUCGCUAAACAGGCCGGGGACAUAAGUGA
RS 3 dot …((((…))))(((((((.(((..((((((((.(((…(((….)))..)))…)))))))))).).)))))))

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table