Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA059279 Similarity: 0.973 Similarity: 0.973 Similarity: 0.973
UTR: 5HSAA059279
Gene: LLPH_0
MFE: -42.894
ENS: 0.951
Length: 116.
Predicted Ligands:
TPP - 9/20
glycine - 4/20
SAM - 3/20
 RS: URS0000C15DCB_1794912
MFE: -38.876
Ligand: glycine
Species: Anaerosporomusa subterranea Glycine riboswitch
 RS: URS0000DAD3AE_1111071
MFE: -35.370
Ligand: glycine
Species: Rhodoferax antarcticus ANT.BR Glycine riboswitch
 RS: URS0000731FE5_318456
MFE: -31.491
Ligand: TPP
Species: Photobacterium kishitanii TPP
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA059279 URS0000C15DCB_1794912 URS0000DAD3AE_1111071 URS0000731FE5_318456
Length 116. 116. 116. 117.
Similarity - 0.973 0.973 0.973
Ensemble Norm 0.951 - - -
MFE -42.894 -38.876 -35.370 -31.491
Ligands - glycine glycine TPP
Gene LLPH - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 7.002 3. 8.
Length SE - 0. 0. 1.
Lev Distance - 33. 35. 32.
UBS 9. 8. 10. 9.
BS 0. 0. 0. 0.
ILL 1. 2. 2. 2.
ILR 2. 2. 3. 3.
H 4. 4. 4. 3.
BL 3. 2. 3. 2.
BR 3. 1. 3. 1.
UN 0.086 0.129 0.103 0.068

Sequences

Field Description
UTR seq + 25 gccccggguggccuccgcccggaagacggaagugcaaagacuuccggucggcgugagcgugagguguggguguucguuucucagguaaaacATGGCTAAAAGCTTACGGAGTAAGT
UTR dot + 25 …((((((((…))))))))..(((((((((……))))))).))(.((((.((.(((((..(((….)))..))))).))….)))).)…..((((((…))))))
RS 1 seq GGAUGGAACUCUGGAGAGCCCCUAGAAAGUGACUGUACUUGCUAGGGCGCCGAAGGGGCAAGUCGGCGGCGAAGGCUGCUGAUGAAACUCUCAGGCAAAAGGACAGAGCAAUCGUU
RS 1 dot ……..(((….))).((((((.(((((….))))).)))))).(((..((((….(((((((((….)))))))))….))))..)))…..(((.((….)))))
RS 2 seq UUCUGCAGGUCAGGAGAGAGCCGCCCAGGCCAACAGGUUUCAGGGCAGCCGCCGAAGGCGCAGGGCCGCUGAUUGCAGCAGUUUGAACGCUCAGGCAAAAGGACUGACAAACGUCG
RS 2 dot ((((.(……).)))).((.(((((((((….)))))..)))).)).(((…((((..((((.((((….)))).))))…))))..)))………(((….))).
RS 3 seq GUGUUCUCAUUGGGGAGCCGUUAGGCUGAGAUUGUUGUUAUGACCUUGAUUGGUAUAGCAGAACCCAUUGAACCUGAACCAGGUAAUGCUGGCGUAGGAAUUGAGAAACGCAUGGGU
RS 3 dot ….((((…….((((….))))))))…(((((((.(((……)))))))))).(((((((.((((((..((((……))))..))))..)).)…….))))))

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table