Detected as a riboswitch by 17 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA059395 Similarity: 0.988 Similarity: 0.988 Similarity: 0.988
UTR: 5HSAA059395
Gene: LMLN
MFE: -10.588
ENS: 0.942
Length: 47.
Predicted Ligands:
glutamine - 8/20
preQ_1 - 6/20
unknown - 3/20
RS: URS0000C7415F_1423769
MFE: -10.735
Ligand: preQ_1
Species: Lactobacillus manihotivorans DSM 13343 = JCM 12514 PreQ1 riboswitch
RS: URS0000C1D245_1423727
MFE: -7.804
Ligand: preQ_1
Species: Lactobacillus brantae DSM 23927 PreQ1 riboswitch
RS: URS0000D6B5F5_12908
MFE: -8.966
Ligand: glutamine
Species: unclassified sequences Glutamine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA059395 URS0000C7415F_1423769 URS0000C1D245_1423727 URS0000D6B5F5_12908
Length 47. 46. 46. 47.
Similarity - 0.988 0.988 0.988
Ensemble Norm 0.942 - - -
MFE -10.588 -10.735 -7.804 -8.966
Ligands - preQ_1 preQ_1 glutamine
Gene LMLN - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3. 9. 10.004
Length SE - 1. 1. 0.
Lev Distance - 14. 12. 13.
UBS 5. 4. 3. 3.
BS 0. 0. 0. 0.
ILL 1. 0. 1. 0.
ILR 1. 1. 1. 1.
H 1. 1. 1. 1.
BL 3. 2. 1. 1.
BR 2. 2. 1. 1.
UN 0.106 0.087 0.087 0.170

Sequences

Field Description
UTR seq + 25 gcgcagaggcgucacgcacuccATGGTAACGACGCTCGGCCCGAAGA
UTR dot + 25 (.((.((.(((((….(((….)))…))))))).)).)…..
RS 1 seq AACGUCGUGGUUCGUGAUCCAUCCCACGUAAAAAAACUAGGAGGCU
RS 1 dot ..(.((.(((((((((……..))))……))))).)).)..
RS 2 seq ACCCUUGUGGUUCGAAAUUCCGCCCACAAUAAAAAACUAGGAGGCA
RS 2 dot ..((((.(((((….(((……..)))….))))).))))..
RS 3 seq AUCGUUCAUCCCAUAAGGGACGCAAAAGCCGACUGAAGGAACGGGAU
RS 3 dot .((.((((((((….))))………….)))).))…….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table