Detected as a riboswitch by 6 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA059481 Similarity: 0.987 Similarity: 0.983 Similarity: 0.982
UTR: 5HSAA059481
Gene: LMX1B
MFE: -20.876
ENS: 0.841
Length: 75.
Predicted Ligands:
fluoride - 10/20
SAM - 7/20
homocysteine - 1/20
 RS: URS0000BFA12C_1660125
MFE: -18.362
Ligand: SAM
Species: Pelagibacterium sp. SCN 64-44 SAM riboswitch (alpha-proteobacteria)
 RS: URS0000BFB278_891974
MFE: -20.448
Ligand: fluoride
Species: Plautia stali symbiont Fluoride riboswitch
 RS: URS0000D9D5F6_604330
MFE: -26.248
Ligand: fluoride
Species: Olsenella sp. lac31 Fluoride riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA059481 URS0000BFA12C_1660125 URS0000BFB278_891974 URS0000D9D5F6_604330
Length 75. 76. 75. 75.
Similarity - 0.987 0.983 0.982
Ensemble Norm 0.841 - - -
MFE -20.876 -18.362 -20.448 -26.248
Ligands - SAM fluoride fluoride
Gene LMX1B - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 4.005 1.011 6.
Length SE - 1. 0. 0.
Lev Distance - 15. 23. 22.
UBS 6. 7. 6. 7.
BS 0. 0. 0. 0.
ILL 0. 1. 0. 2.
ILR 1. 1. 1. 2.
H 2. 2. 2. 2.
BL 2. 3. 2. 2.
BR 3. 4. 2. 3.
UN 0.120 0.053 0.227 0.120

Sequences

Field Description
UTR seq + 25 ccgagucgcuggagaggugcuucccucgcgggcagacggacugcgccaagATGGATATAGCAACAGGTCCCGAGT
UTR dot + 25 ….((((((.(.((((……)))).).))).)))(((((((……………)))….))))…..
RS 1 seq UCGCAGCCCAGUGGUGAUUUGGCCGGUCGCUUGCAGCCACUCAAAACAAAUUGCUAAAGACCGUCUUGAGCCGGCC
RS 1 dot ..(((((..(.((((……)))).).))).)).(((.(((((.((……………)).)))))..))).
RS 2 seq UGCCUCUGAGGUGAUGGCGUGCCACCUUACCCAACCGCCCUCAGGUCACAGACGGCUGAUGACGCCUGACAACUU
RS 2 dot …..((((((((.(((.(((……))))))..)))).))))(((((((….))).))))…………
RS 3 seq UGUUCCGUGCGGAAUGAGGUUCUCCGCGGGGCAGAAGCCCCAAACCGCCUUCGGGAUGAUGACCUCUGCCACUGU
RS 3 dot ….(((((.(((((…))))).)))))((((((.((..((..(((….)))..))..).).))))))…..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table