Detected as a riboswitch by 16 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA060232 Similarity: 0.988 Similarity: 0.988 Similarity: 0.987
UTR: 5HSAA060232
Gene: LRGUK
MFE: -8.990
ENS: 0.951
Length: 41.
Predicted Ligands:
preQ_1 - 12/20
SAM - 7/20
zmp-ztp - 1/20
 RS: URS0000C32C8D_666686
MFE: -5.142
Ligand: preQ_1
Species: Bacillus sp. 1NLA3E PreQ1 riboswitch
 RS: URS00023316D7_471853
MFE: -15.636
Ligand: zmp-ztp
Species: Beutenbergia cavernae DSM 12333 ZMP/ZTP riboswitch
 RS: URS0000ABBAC0_1321606
MFE: -5.042
Ligand: preQ_1
Species: Bacillus selenatarsenatis SF-1 PreQ1 riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA060232 URS0000C32C8D_666686 URS00023316D7_471853 URS0000ABBAC0_1321606
Length 41. 43. 41. 43.
Similarity - 0.988 0.988 0.987
Ensemble Norm 0.951 - - -
MFE -8.990 -5.142 -15.636 -5.042
Ligands - preQ_1 zmp-ztp preQ_1
Gene LRGUK - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 2.047 3.015 2.022
Length SE - 4. 0. 4.
Lev Distance - 11. 16. 13.
UBS 2. 1. 3. 2.
BS 0. 0. 0. 0.
ILL 0. 0. 1. 0.
ILR 0. 0. 1. 0.
H 2. 1. 2. 1.
BL 0. 0. 0. 1.
BR 0. 0. 0. 0.
UN 0.317 0.535 0.195 0.465

Sequences

Field Description
UTR seq + 25 aaccccgcuaaacaagATGGCGACCTCCGAGAGGGCTCTCC
UTR dot + 25 …..(((((…….))))).((((…))))…….
RS 1 seq UAUAAAGAGGUUCUAGCUACCCUCUCAAAAAAACUAAGGAAAA
RS 1 dot …..(((((……….)))))………………
RS 2 seq GUCGCGACUGGCGCCGAGGUGGAUCACCACCGGGGAGCGAC
RS 2 dot ..(((…..)))((..(((((….)))))..))……
RS 3 seq ACGGAAGAGGUUCUAGCUACCCUCUCAAAAAAACUAAGGGAAA
RS 3 dot …(.(((((……….))))))……………..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table