Detected as a riboswitch by 11 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA060545 Similarity: 0.983 Similarity: 0.983 Similarity: 0.982
UTR: 5HSAA060545
Gene: LRRC42
MFE: -24.442
ENS: 0.836
Length: 100.
Predicted Ligands:
tetrahydrofolate - 16/20
purine - 3/20
TPP - 1/20
 RS: URS0000C82977_768486
MFE: -18.
Ligand: tetrahydrofolate
Species: Enterococcus hirae ATCC 9790 THF riboswitch
 RS: URS0000DAF70A_1158604
MFE: -18.
Ligand: tetrahydrofolate
Species: Enterococcus villorum ATCC 700913 THF riboswitch
 RS: URS0000C14F75_1158610
MFE: -21.
Ligand: tetrahydrofolate
Species: Enterococcus phoeniculicola ATCC BAA-412 THF riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA060545 URS0000C82977_768486 URS0000DAF70A_1158604 URS0000C14F75_1158610
Length 100. 99. 99. 100.
Similarity - 0.983 0.983 0.982
Ensemble Norm 0.836 - - -
MFE -24.442 -18. -18. -21.
Ligands - tetrahydrofolate tetrahydrofolate tetrahydrofolate
Gene LRRC42 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 6.001 6.001 10.001
Length SE - 1. 1. 0.
Lev Distance - 19. 19. 20.
UBS 7. 7. 7. 6.
BS 0. 0. 0. 0.
ILL 2. 2. 2. 2.
ILR 3. 4. 4. 4.
H 1. 1. 1. 1.
BL 0. 2. 2. 2.
BR 3. 2. 2. 1.
UN 0.130 0.101 0.101 0.

Sequences

Field Description
UTR seq + 25 cggggcgcggguugaggggaggaugaggcuucauccagugaauacuagagggaucgaacaguugcaaccaaggcaATGTCTTACTACCTCAGCTCAGAAA
UTR dot + 25 ……..(((((((((((((((((..(((((((((..(……..)..)))).))…………..)))..)))))).)).)))))))))…..
RS 1 seq AACAGAGUAGAAAAUAAAGCGUUAAGUGCUGAGAGGAUGGGAUGUUGCCUCUUUGACGAAGGACAAGUUGUUCGCGGUUUUAUUUUCGCAUUCGCUGCA
RS 1 dot ….((((.(((((((((((((.((..(((((((((..(…..)..))))))…………)))..)).))).))))))))))..))))……
RS 2 seq AACAGAGUAGAAAAUAAAGCGUUAAGUGCUGAGAGGAUGGGAUGUUGCCUCUUUGACGAAGAACUGGUUGUUCGCGGUUUUAUUUUCGCAUUCGCUGCA
RS 2 dot ….((((.(((((((((((((.((..(((((((((..(…..)..))))))…………)))..)).))).))))))))))..))))……
RS 3 seq UUCAGAGUAGAAAACGAAGCGUUAAGUGCUAAAAGGAUGGGAUGUUGCCUUUUGGACGAAGAAUGGAUUCAUUCGCGGUUUUGUUUUCGCAUUCGCUGCA
RS 3 dot ….((((.(((((((((((..(.((((((((((((..(…..)..))))))))…………..)))).)..)))))))))))..))))……

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table