Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA060547 Similarity: 0.991 Similarity: 0.990 Similarity: 0.990
UTR: 5HSAA060547
Gene: LRRC43
MFE: -19.171
ENS: 0.975
Length: 50.
Predicted Ligands:
unknown - 12/20
glutamine - 3/20
SAM - 3/20
 RS: URS0000D6C9EA_397945
MFE: -16.683
Ligand: unknown
Species: Acidovorax citrulli AAC00-1 nhaA-I RNA
 RS: URS0000D659B1_12908
MFE: -19.543
Ligand: unknown
Species: unclassified sequences nhaA-I RNA
 RS: URS0000D6BBBA_12908
MFE: -12.930
Ligand: unknown
Species: unclassified sequences DUF1646 RNA
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA060547 URS0000D6C9EA_397945 URS0000D659B1_12908 URS0000D6BBBA_12908
Length 50. 51. 51. 49.
Similarity - 0.991 0.990 0.990
Ensemble Norm 0.975 - - -
MFE -19.171 -16.683 -19.543 -12.930
Ligands - unknown unknown unknown
Gene LRRC43 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 5.001 6. 9.004
Length SE - 1. 1. 1.
Lev Distance - 9. 10. 9.
UBS 5. 4. 4. 3.
BS 0. 0. 0. 0.
ILL 1. 1. 1. 1.
ILR 1. 1. 0. 1.
H 2. 2. 2. 2.
BL 1. 1. 1. 0.
BR 2. 0. 0. 0.
UN 0.080 0.118 0.078 0.143

Sequences

Field Description
UTR seq + 25 guugccgggcaacgcggcccgggccATGGAGGCGTCGTACGAGTCCGAGT
UTR dot + 25 …(((((((……)))))).)(.((((..(((…)))..)))).).
RS 1 seq GGGUGCCGUCACAUGGGGUGCGGCAGGUGUAGCGAAGGUCGGGCCGCCUCG
RS 1 dot ….((((.(((…..)))))))(((((…(((…)))…)))))..
RS 2 seq GGGUGUGCUACUUUCCGUAGCACAGGUUUUGGGCAGGUCGGGCCGCCUCCC
RS 2 dot …((((((((…..))))))))((….((((.(((…))))))))).
RS 3 seq GGUUGGGCAGGUAACUGCUUUCAAGUUUUGAGCUUAAGGGUGGAAAGCU
RS 3 dot ….((((((….))))))…((((((..(((….)))..))))))

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table