Detected as a riboswitch by 9 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA060665 Similarity: 0.949 Similarity: 0.949 Similarity: 0.949
UTR: 5HSAA060665
Gene: LRRCC1
MFE: -37.420
ENS: 0.845
Length: 189.
Predicted Ligands:
lysine - 16/20
cobalamin - 4/20

 RS: URS0000C0C749_1262962
MFE: -44.285
Ligand: lysine
Species: Ruminococcus sp. CAG:57 Lysine riboswitch
 RS: URS0000AB2487_398511
MFE: -55.795
Ligand: lysine
Species: Bacillus pseudofirmus OF4 Lysine riboswitch
 RS: URS0000D99F8D_1532552
MFE: -51.787
Ligand: lysine
Species: Anaerobacillus sp. NB2006 Lysine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA060665 URS0000C0C749_1262962 URS0000AB2487_398511 URS0000D99F8D_1532552
Length 189. 189. 189. 188.
Similarity - 0.949 0.949 0.949
Ensemble Norm 0.845 - - -
MFE -37.420 -44.285 -55.795 -51.787
Ligands - lysine lysine lysine
Gene LRRCC1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 7.005 6. 3.
Length SE - 0. 0. 1.
Lev Distance - 65. 66. 66.
UBS 12. 12. 12. 11.
BS 0. 0. 0. 0.
ILL 1. 0. 2. 1.
ILR 0. 0. 2. 1.
H 7. 8. 7. 7.
BL 4. 2. 3. 3.
BR 3. 4. 3. 3.
UN 0.095 0.169 0.101 0.085

Sequences

Field Description
UTR seq + 25 uuuuguauguaaggauuuaaugauuacaugcugcagaaguugaauaaguaacaaguuuauuauuugcuuucuggaacuauuccgggugauguaucugguagcugauaaauuuaguuuauucuagaaauaauugacuuuuuuuaauauuucaguuuucauuuugaATGGAGGCGGCGGCGGCGGTGGTGG
UTR dot + 25 ….((((((((………..))))))))(.((((((.(((((((…………))))))).)))))).).(((..(((((((…))))))))))((((…..))))………(((((.(((((……)))))))))).(((((((((…))))))))).((.((….)).))..
RS 1 seq AGAACAGAUAGAGGUGCAGUUGAAAUGAGUAUCAUUUUUCGUGUGACCCCACACAACAGCGUCCCAACGCCUAUGGUAAAUGAGAAAGGUAAAACUGCCGAAGCGGAGUAUCGGGAACACUCCUGCUGACUGUUAGUUUAAUAGACUAUCAGUUGUCAUCAUUACAAAUGGUGGAGUGCUAUCGGCAUA
RS 1 dot ……((.((((((((………..))))).))).))(((((….)))))….((((….))))……………..((((….))))..((((((((………))))).)))(((((.((((((…)))))).))))).((((((((…)))))))).(((((…))))).
RS 2 seq AGUGAUGGUAGAGGAGCGAAAACCAUUAGUAAACCAGUUGAGAGCGAUGAGGUUCUAAGACACUGGUUAAAAGGGGAAUUCGCCGAAGUUUGUAUAGAGCUCAUAGCUAUGCAUGCUGGACUUAUCUCGAACAGAGAUAAGGCUGUCACUUGACUAUACCCAAUAGUCUUGUGGAGAACUAUCUCACGU
RS 2 dot (.(((((((…………))))))).).(((((((..(((((……)))))…..)))))))….((.(….).))..(((.(((((((………))))))).)))…((((((((…..))))))))…..(((..((((((…..))))))..)))((((….))))….
RS 3 seq AGUGGUGGUAGAGGAGCAAAAACUAUUAGUAUGUUAUCGGAGGACGAUGAGGUCCAGUGAAGAUAGCAAAAAGGGGAAUUUGCCGAAGUUUAAAGAGAACUCAUGACUCUUUAUGCUGGACCUGCAUUAAAGAAAUGUAGGGCUGUCACACAGUCGCCCCAAUGAUUGUGUGGAGAACUAUCUCACGC
RS 3 dot (.(((((((…………))))))).).((((.(((..((((……))))..))).))))(((((……..)))))…(((.(((((((………))))))).)))…((((((((…..))))))))…..((((((((((……))))))))))((((….))))….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table