Detected as a riboswitch by 9 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA060812 Similarity: 0.977 Similarity: 0.976 Similarity: 0.975
UTR: 5HSAA060812
Gene: LRSAM1
MFE: -26.895
ENS: 0.840
Length: 102.
Predicted Ligands:
tetrahydrofolate - 8/20
purine - 7/20
TPP - 3/20
 RS: URS0000AB250A_343509
MFE: -19.349
Ligand: TPP
Species: Sodalis glossinidius str. 'morsitans' TPP riboswitch (THI element)
 RS: URS0000C1BA6C_1216932
MFE: -12.126
Ligand: purine
Species: Clostridium bornimense Purine riboswitch
 RS: URS0000C3EE66_363870
MFE: -18.866
Ligand: purine
Species: Bacillus ginsengihumi Purine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA060812 URS0000AB250A_343509 URS0000C1BA6C_1216932 URS0000C3EE66_363870
Length 102. 101. 102. 103.
Similarity - 0.977 0.976 0.975
Ensemble Norm 0.840 - - -
MFE -26.895 -19.349 -12.126 -18.866
Ligands - TPP purine purine
Gene LRSAM1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 8. 6.001 4.005
Length SE - 1. 0. 1.
Lev Distance - 26. 30. 31.
UBS 8. 9. 8. 8.
BS 0. 0. 0. 0.
ILL 1. 2. 2. 2.
ILR 2. 3. 2. 2.
H 2. 1. 1. 1.
BL 4. 4. 2. 5.
BR 2. 4. 2. 1.
UN 0.039 0.040 0.069 0.107

Sequences

Field Description
UTR seq + 25 aucaggaagggggugcaagaggguuagugauuggggagcagaagggguccuaaagaucgcucugggaaaagggaaggATGCCGCTCTTCTTCCGGAAGCGGA
UTR dot + 25 …((((((((.(.((((((……((((((.((((.(……).))))…)))))))))……………)))).))))))))(((….))).
RS 1 seq AUCAAUGAAUAAGGGCGCCCUAACCGCCAGGUGAAGGCUGAGAAAUACCCGUAUUACCUGAACUGGAUCAUGCUAGCGUAGGGAAGUCACAGUAUCCAUUC
RS 1 dot …((((.(((.((((.(((((..((((((((((..((.(……..).)).)))))))……………))))))))..))).)..))).)))).
RS 2 seq AAUUAACUAAGAUUAAUAGCUCAUAUAAUUUUGGCGAUAGGGGUCAUAAGUUUCUACCAAGAUACCGUAAACAUCUUGACUAUGAGUAUAUAUAAUUGAAGA
RS 2 dot ……((..((((((((((((((((.(((((((…((((((.(….)))))))))))))))…………….))))))).))).)))))..)).
RS 3 seq AUGAUCAUAAAUAACUAUCCUUGUAUAAUAUCAGUUACAUGGCCUGAUAGUCUCUACCUGACAGCCGUUAAAAUGUCAGACUACAAGGAAGUAUGAAAAGAUA
RS 3 dot ….((((…..(((.((((((((……((.(((.((((.(((.(((…….))).))))))))))..))……)))))))))))))))…….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table