Detected as a riboswitch by 11 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA060917 Similarity: 0.981 Similarity: 0.978 Similarity: 0.978
UTR: 5HSAA060917
Gene: LSM5
MFE: -25.470
ENS: 0.869
Length: 95.
Predicted Ligands:
TPP - 17/20
cobalamin - 2/20
glutamine - 1/20
 RS: URS0002325F9B_1801887
MFE: -34.055
Ligand: cobalamin
Species: Candidatus Pacebacteria bacterium RIFCSPLOWO2_01_FULL_47_12 AdoCbl variant RNA
 RS: URS0000C48CF3_1262770
MFE: -23.566
Ligand: TPP
Species: Clostridium sp. CAG:1024 TPP riboswitch (THI element)
 RS: URS0000BEE930_1338009
MFE: -16.930
Ligand: TPP
Species: Sphingobacterium sp. IITKGP-BTPF85 TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA060917 URS0002325F9B_1801887 URS0000C48CF3_1262770 URS0000BEE930_1338009
Length 95. 95. 96. 94.
Similarity - 0.981 0.978 0.978
Ensemble Norm 0.869 - - -
MFE -25.470 -34.055 -23.566 -16.930
Ligands - cobalamin TPP TPP
Gene LSM5 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 7. 4. 2.004
Length SE - 0. 1. 1.
Lev Distance - 23. 27. 28.
UBS 6. 6. 5. 6.
BS 0. 0. 1. 0.
ILL 1. 0. 0. 1.
ILR 2. 1. 2. 1.
H 2. 2. 2. 2.
BL 3. 2. 2. 3.
BR 1. 3. 1. 2.
UN 0.221 0.211 0.229 0.160

Sequences

Field Description
UTR seq + 25 agagccugugguguccgcgggaccuggagagcuuguggacaaauguauaggaucaagaauucacaucgugATGAAGAGTGATAAGGAAATTGTTG
UTR dot + 25 .((.((((((.((((((((((..(….)..))))))))))….)))))).))……((((.((……..))))))…………..
RS 1 seq UGGUAUAGUGGCCUUGCUGUGGAACACGGUGAGAAUCCGUGACUGUGCCGCAACGGUGUUUGGCUCGUGCCAAAAGUCCGAUCUUCAGCACACUA
RS 1 dot .((((((((.(((((((((((…)))))))))…..)).))))))))….((((.((((((….)))))).).)))……………
RS 2 seq ACAGUGUCACGGGUGCAUUCCAUGAAAAUGGGAUUGAGAAGCAGCCUUCGAACCUGUUGGGUAAUGCCAUCGUAGGAAAGUGACGCGAGCAAAUUC
RS 2 dot …(((((((((.((((((((((….)))))))……))).))……((((.(((……)))…))))…)))))))……….
RS 3 seq GUUAUGCUUUAGGGGUAUUCUAAAAAAGAAUUGAGAGAGUCCCUUUGAACCUGACACGGCUAAUACCGACGUAGGGAAAAGCAAUACAGUACAC
RS 3 dot ((((.(.((((((((.(((((…………..))))).))))))))).))))…(((….((……))….)))…………

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table