Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA060921 Similarity: 0.987 Similarity: 0.985 Similarity: 0.982
UTR: 5HSAA060921
Gene: LSM8
MFE: -28.081
ENS: 0.982
Length: 82.
Predicted Ligands:
cyclic-di-GMP - 5/20
glycine - 4/20
zmp-ztp - 3/20
 RS: URS0000AB3A48_1263065
MFE: -19.450
Ligand: glycine
Species: Clostridium clostridioforme CAG:132 Glycine riboswitch
 RS: URS0000AB9D57_1263064
MFE: -16.350
Ligand: glycine
Species: Clostridium bolteae CAG:59 Glycine riboswitch
 RS: URS0000C83A07_114615
MFE: -29.042
Ligand: zmp-ztp
Species: Bradyrhizobium sp. ORS 278 ZMP/ZTP riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA060921 URS0000AB3A48_1263065 URS0000AB9D57_1263064 URS0000C83A07_114615
Length 82. 82. 82. 81.
Similarity - 0.987 0.985 0.982
Ensemble Norm 0.982 - - -
MFE -28.081 -19.450 -16.350 -29.042
Ligands - glycine glycine zmp-ztp
Gene LSM8 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3.001 6.001 13.003
Length SE - 0. 0. 1.
Lev Distance - 17. 18. 18.
UBS 7. 6. 7. 7.
BS 0. 0. 0. 0.
ILL 0. 0. 2. 2.
ILR 1. 2. 1. 3.
H 1. 1. 1. 1.
BL 4. 3. 3. 2.
BR 2. 2. 3. 3.
UN 0.061 0.098 0.098 0.111

Sequences

Field Description
UTR seq + 25 ucaguucugcuugcugucggcaccgcugcguuacccggaaccgccgggccgaacagcATGACGTCCGCTTTGGAGAACTACA
UTR dot + 25 ..((((((.((((((((((((.(((.((.(((……))))).)))))))).)))))………….))))))))…
RS 1 seq UUGAUGAAUUCGGGAGAGAUUACCGUUGGGUAACGCCGAAGGGGAUGCGCAAACUCUCAGGCAAAAGAAUCGAAUUCGGACG
RS 1 dot ….(((((((((((((((((.((.((.(((…))).)).)))))…….)))))………..)))))))))….
RS 2 seq UUGAUGAAUUCGGGAGAGAUUACCGCCAGGUAACGCCGAAGGGGAUGCGCAAACUCUCAGGCAAAAGAAUCGAAUUCGGACG
RS 2 dot ….((((((((((((((.((…((…(((.(.((…)).).))))).)))))))………..)))))))))….
RS 3 seq CGGCUCUCGCGCGACUGGCGACUUUGGAUGGAGCACCAUCGGGGAGCGCGGGAUCGACCGCCGUGCGCCUGGGCAACUGAA
RS 3 dot ..((((..((((((((.(((..(((.(((((….))))).)))..))).)).))………))))..))))…….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table