Detected as a riboswitch by 16 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA061041 Similarity: 0.977 Similarity: 0.976 Similarity: 0.975
UTR: 5HSAA061041
Gene: LTK
MFE: -45.075
ENS: 0.889
Length: 112.
Predicted Ligands:
TPP - 18/20
preQ_1 - 1/20
glycine - 1/20
 RS: URS0000DB1130_1797678
MFE: -24.137
Ligand: TPP
Species: Clostridiales bacterium GWC2_40_7 TPP riboswitch (THI element)
 RS: URS0000C391B6_315405
MFE: -22.239
Ligand: preQ_1
Species: Streptococcus gallolyticus preQ1-II (pre queuosine) riboswitch
 RS: URS0000BF2BD4_1262958
MFE: -32.
Ligand: TPP
Species: Ruminococcus sp. CAG:403 TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA061041 URS0000DB1130_1797678 URS0000C391B6_315405 URS0000BF2BD4_1262958
Length 112. 112. 113. 112.
Similarity - 0.977 0.976 0.975
Ensemble Norm 0.889 - - -
MFE -45.075 -24.137 -22.239 -32.
Ligands - TPP preQ_1 TPP
Gene LTK - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3.029 7.003 3.
Length SE - 0. 1. 0.
Lev Distance - 30. 29. 32.
UBS 8. 7. 8. 9.
BS 0. 0. 0. 0.
ILL 2. 2. 3. 2.
ILR 2. 2. 1. 3.
H 3. 2. 2. 3.
BL 3. 2. 3. 2.
BR 1. 1. 3. 1.
UN 0.045 0.214 0.097 0.027

Sequences

Field Description
UTR seq + 25 ccguggcaaaaugagcugucaacuuuagguugacagggguguggccgcgaccgcaagggcuuuuguugccggguggacccaacagggATGGGCTGCTGGGGACAGCTGCTGG
UTR dot + 25 .((((((……..(((((((((…)))))))))…….)))))).((….))((..(((((.((.(((((.((((…….))))))))).)))))))..))…
RS 1 seq UUAUUGUGCUAGGGGUGCUGGAUAGGCCGGCUGAGAUAAAGACCCGUUUUAAGUCUUUGACCCUUUACCUGAUCUGGAUAAUGCCAGCGAAGGGAAGUUAAACGCUAAUUAU
RS 1 dot …………(((((((((…..)))))……….))))……(((.((((((..(((.(((…((((……))))…)))))))))))).)))……
RS 2 seq UGUGCUAUACUUUUAAGCGUUGUGAAAACAACCCUUGACGCUUAGUUCCCUUUCGUCAAGCAUAUUAGAGACGUGAAGAAUUGUCGCUCUUUAACGUUAAAGGAGAAAAAAUU
RS 2 dot .(.((((…..(((((.(((((….))))).)))))….)))).)(((((…..(((…(((((((.((((…….))))))))))).))))))))……….
RS 3 seq CUUCUCUGUUUCGGGAGCUUGCUGUUUGCAGGCUGAGAGGAAUCGAACGAACGAUUCGACCGUUUCACCUGAUUUGGAUAAUGCCAACGCAGGGAAUCCCAGGGCAUCGCUU
RS 3 dot ((((((………(((((((…..)))))))))))))(((((……)))))(((((.((((.((((..((((……))))..)))))))….).))..)))…

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table