Detected as a riboswitch by 19 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA061047 Similarity: 0.967 Similarity: 0.966 Similarity: 0.965
UTR: 5HSAA061047
Gene: LUC7L
MFE: -41.133
ENS: 0.943
Length: 136.
Predicted Ligands:
TPP - 6/20
cobalamin - 4/20
glycine - 3/20
 RS: URS0000C63C23_1286631
MFE: -52.903
Ligand: glycine
Species: Sphaerotilus natans subsp. natans DSM 6575 Glycine riboswitch
 RS: URS0000C4A992_857566
MFE: -25.087
Ligand: TPP
Species: Nadsonia fulvescens var. elongata DSM 6958 TPP riboswitch (THI element)
 RS: URS0000D992DD_1121868
MFE: -36.186
Ligand: molybdenum
Species: Enterovibrio nigricans DSM 22720 Moco (molybdenum cofactor) riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA061047 URS0000C63C23_1286631 URS0000C4A992_857566 URS0000D992DD_1121868
Length 136. 137. 135. 136.
Similarity - 0.967 0.966 0.965
Ensemble Norm 0.943 - - -
MFE -41.133 -52.903 -25.087 -36.186
Ligands - glycine TPP molybdenum
Gene LUC7L - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 11.005 7.004 13.003
Length SE - 1. 1. 0.
Lev Distance - 37. 41. 39.
UBS 13. 11. 11. 10.
BS 0. 0. 0. 0.
ILL 2. 2. 3. 3.
ILR 3. 4. 4. 2.
H 3. 4. 3. 3.
BL 4. 3. 4. 3.
BR 5. 3. 4. 4.
UN 0.147 0.073 0.081 0.096

Sequences

Field Description
UTR seq + 25 gaaagagccgagugggcucgaggccgacgcgaccaucguuugucgacgccgcugccaccgccugccugagagaagucgucgcggccgaccccgucgccuccgccggcuaccATGGATTTAGGAGAATGTACCAAAA
UTR dot + 25 ….(((((…..)))))..(((((.((((((……..)))).)).))..)))..(.((((((((.(…(((((..((((.((((…))))…))))))))).))).))…)))).)…………
RS 1 seq CGACACCUCACUGGAGAGAGGCCGUGGGCGUCACCCUCAAGCGACGCGACGCGGUCCACCGAAGGGGCAAGCGCUGCGCGAUCCAACCGGAUCCGCUCGGCGUCAAUCUCUCAGGUAAAGCGGACAGCGAGGGCAGC
RS 1 dot …..((((……..))))(((((.(((((.(……).)))))..)))))((((((..(((((…((((((.(((((((….))))).)).))))))…)))))..)))…..)))..((….))…
RS 2 seq GUGAAAGCUAACGGGUGUCACUGUGGAUAUUUUGGCGUUUGUUAAAACCCUAAAAUAUAACCUUAUAUGACUGAGAUUACACCGUAUGAACUCGAUCAAGAUAAUGCUUGCGUGAGAAUAGUCUUAUAUCCUUUC
RS 2 dot ((((..(((….))).))))…(((((((((((.((((….)))).)))))))))..)).((((.(((((…((((.(.((((….((……))..))))..).))))…))))).))))…….
RS 3 seq GAGUAUUAGUAACUCCGAAGCCUAUUUUGCUAAGUUCGAAAGAAUAGGGGAAAUAGGCCGUGACAUACCGUCACCAGGGCGCUCAUAGAAAUGUGGUCGUCUCCCGUAUUUGGAAAGGUGUUUCGUAGCAAUGCAA
RS 3 dot ((((…….))))((..(((((((((.((..((((….)))).)).))))))))))).((.(((((….((((((((.(((((….))))).)))))……..)))…))))).))…………

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table