Detected as a riboswitch by 17 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA061186 Similarity: 0.986 Similarity: 0.985 Similarity: 0.984
UTR: 5HSAA061186
Gene: LYPLAL1
MFE: -28.309
ENS: 0.902
Length: 66.
Predicted Ligands:
fluoride - 11/20
guanine - 4/20
cobalamin - 2/20
RS: URS0002327791_665007
MFE: -25.102
Ligand: fluoride
Species: Streptomyces incarnatus Fluoride riboswitch
RS: URS0000D94C48_1678012
MFE: -25.195
Ligand: fluoride
Species: Streptomyces sp. MUSC 1 Fluoride riboswitch
RS: URS0000E6028E_1457173
MFE: -24.016
Ligand: unknown
Species: Comamonas aquatica DA1877 nhaA-I RNA
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA061186 URS0002327791_665007 URS0000D94C48_1678012 URS0000E6028E_1457173
Length 66. 66. 66. 64.
Similarity - 0.986 0.985 0.984
Ensemble Norm 0.902 - - -
MFE -28.309 -25.102 -25.195 -24.016
Ligands - fluoride fluoride unknown
Gene LYPLAL1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3.001 7.008 2.001
Length SE - 0. 0. 4.
Lev Distance - 18. 18. 17.
UBS 7. 6. 5. 6.
BS 0. 0. 0. 0.
ILL 1. 2. 1. 1.
ILR 1. 1. 1. 1.
H 2. 2. 1. 2.
BL 2. 2. 3. 3.
BR 3. 2. 2. 3.
UN 0.030 0. 0.121 0.062

Sequences

Field Description
UTR seq + 25 aacgcaggggcggaaccgcaugacuggcaguggcaucagcgATGGCGGCTGCGTCGGGGTCGGTTC
UTR dot + 25 ..(((….)))(((((((.((((..(((((.(((((…)))).).)))))))))..).))))))
RS 1 seq CUGGUAUCCGGCGACGGGGCUCGCCGCCGACCGCACCGACGCGGUGCCGAUGGCCUCUACCCGCUG
RS 1 dot ((((…))))((.((((….((((.((…((((((…)))))))).))))…..)))).))
RS 2 seq CUGGUAUCCGGCGAUGGGGCUCGCCGCCAACCGCACCCCUGGGGUGCUGAUGGCCUCUACCCGCUG
RS 2 dot ……..(((((.(((((……((((.(.((((((…)))))).).)))))))))..)))))
RS 3 seq GGGUGCCCGCCACAUGCGGUGGUGAUGGCAGGUGAAUGUUCAUGUGCAAGUCGGGCCGCUUGCA
RS 3 dot .(((….))).((.(((((..((((.(((.((((….)))).)))..)))).))))).))..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table