Detected as a riboswitch by 1 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA061187 Similarity: 0.985 Similarity: 0.983 Similarity: 0.983
UTR: 5HSAA061187
Gene: LYPLAL1_0
MFE: -28.309
ENS: 0.818
Length: 72.
Predicted Ligands:
fluoride - 11/20
cobalamin - 4/20
homocysteine - 2/20
 RS: URS00021EDE05_12908
MFE: -23.511
Ligand: guanidine
Species: unclassified sequences guanidine-IV riboswitch
 RS: URS0000C000B7_592316
MFE: -14.898
Ligand: fluoride
Species: Pantoea sp. At-9b Fluoride riboswitch
 RS: URS000233028F_1802037
MFE: -21.601
Ligand: cobalamin
Species: Candidatus Roizmanbacteria bacterium RIFCSPHIGHO2_02_FULL_37_24 AdoCbl variant RNA
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA061187 URS00021EDE05_12908 URS0000C000B7_592316 URS000233028F_1802037
Length 72. 73. 72. 71.
Similarity - 0.985 0.983 0.983
Ensemble Norm 0.818 - - -
MFE -28.309 -23.511 -14.898 -21.601
Ligands - guanidine fluoride cobalamin
Gene LYPLAL1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 4.012 1.005 9.005
Length SE - 1. 0. 1.
Lev Distance - 18. 22. 18.
UBS 7. 6. 6. 5.
BS 0. 0. 0. 0.
ILL 1. 0. 1. 2.
ILR 1. 0. 1. 0.
H 2. 2. 2. 1.
BL 2. 2. 2. 1.
BR 3. 4. 3. 2.
UN 0.111 0.219 0.042 0.183

Sequences

Field Description
UTR seq + 25 cgcggcaacgcaggggcggaaccgcaugacuggcaguggcaucagcgATGGCGGCTGCGTCGGGGTCGGTTC
UTR dot + 25 ……..(((….)))(((((((.((((..(((((.(((((…)))).).)))))))))..).))))))
RS 1 seq UAACAAUCGCCGCCGGGUGACACCCACCAGUUCCGUUAGGCCUUGAAGGAACUUGGAGGAGUGUCUUCUUUUU
RS 1 dot ……..(((….)))(((((((.((((((((.(((…..))).)))))).)).)).)))))……..
RS 2 seq UGAGUCGAAGGUGAUGGCGUUCCACCUUAUCCAAACCGCUCCCUCGCUGGAGCUGAUGACGCCUGGUAUGUC
RS 2 dot …((((….))))(((((.((((.(((((……(((((……))))).))))).)..))).)))))
RS 3 seq CUUUGGUAGUGGGAACACGGUGUGAUUCCGUGACUGUGCCGCAACGGUAAUAGUCCGACACCACCCAAUAG
RS 3 dot ………((((…..(((((…..((.((((((((((…))))).)))))))))))).))))….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table