Detected as a riboswitch by 16 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA061190 Similarity: 0.983 Similarity: 0.981 Similarity: 0.978
UTR: 5HSAA061190
Gene: LYPLAL1_1
MFE: -23.982
ENS: 0.911
Length: 99.
Predicted Ligands:
purine - 6/20
glycine - 5/20
TPP - 3/20
 RS: URS0000AB4E79_999541
MFE: -35.445
Ligand: glycine
Species: Burkholderia gladioli BSR3 Glycine riboswitch
 RS: URS0000C7201B_595500
MFE: -34.271
Ligand: glycine
Species: Burkholderia glumae PG1 Glycine riboswitch
 RS: URS0000C26C2B_68223
MFE: -46.552
Ligand: zmp-ztp
Species: Streptomyces katrae ZMP/ZTP riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA061190 URS0000AB4E79_999541 URS0000C7201B_595500 URS0000C26C2B_68223
Length 99. 99. 99. 100.
Similarity - 0.983 0.981 0.978
Ensemble Norm 0.911 - - -
MFE -23.982 -35.445 -34.271 -46.552
Ligands - glycine glycine zmp-ztp
Gene LYPLAL1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 6.001 5.008 4.
Length SE - 0. 0. 1.
Lev Distance - 21. 24. 27.
UBS 7. 9. 7. 8.
BS 0. 0. 0. 0.
ILL 0. 1. 2. 1.
ILR 2. 3. 2. 1.
H 3. 3. 3. 4.
BL 2. 2. 2. 2.
BR 2. 2. 1. 2.
UN 0.040 0.071 0.131 0.020

Sequences

Field Description
UTR seq + 25 augaaaagcuugucagacuuuucgaagaaaguggucuuugagccgagacgggugauucuggacaaggauuaagaATGGCGGCTGCGTCGGGGTCGGTTC
UTR dot + 25 .(((((((((….)).)))))))…((((….))))(((((((((((.((.(((((…………))))).))…..))))….)))))))
RS 1 seq CGGCACGCGUCGGGAGAGCGUGCGACAGCCUGGAUUCCGGGCCGCCGCGCCGCCGAAGGGGCACACCCACAAACUCUCAGGCAAAAGGACCGACCGCGU
RS 1 dot ..((((((.((….))))))))….((((((…))))))(((.((((((((..((((………….))))..)))….))..)).).))).
RS 2 seq CGGCACGCGUCGGGAGAGCGUGCGACCGUUUGUCAUCAAACCGGUCGUGCCGCCGAAGGGGCAUACCCAGAAACUCUCAGGCAAAAGGACCGAACGCGU
RS 2 dot ..((((((.((….))))))))….(((((….)))))(((((.(…(((..((((………….))))..)))…).)))))…….
RS 3 seq GAGCAGGGCCGUGACUGGCGUUCGGGUGGAUCACCACCGGGGAGCGGCCCGGCGUACGCACCUCCCCGUACGUCGACUGCCGCGCGCCUGGGCGAACCGC
RS 3 dot ((((…((((….)))))))).((((…)))).((((((.(((((.(((((((((……..)))))))))…))))).).)))))(((…)))

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table