Detected as a riboswitch by 14 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA061223 Similarity: 0.949 Similarity: 0.943 Similarity: 0.936
UTR: 5HSAA061223
Gene: LYSMD4
MFE: -76.860
ENS: 0.752
Length: 214.
Predicted Ligands:
cobalamin - 19/20
glucosamine - 1/20

 RS: URS000233085B_155892
MFE: -91.373
Ligand: cobalamin
Species: Caulobacter vibrioides Cobalamin riboswitch
 RS: URS0002322871_1883416
MFE: -69.864
Ligand: cobalamin
Species: Halomonas sp. 1513 Cobalamin riboswitch
 RS: URS0002318BCA_1986850
MFE: -64.189
Ligand: cobalamin
Species: Rhizobiales bacterium TMED162 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA061223 URS000233085B_155892 URS0002322871_1883416 URS0002318BCA_1986850
Length 214. 215. 214. 214.
Similarity - 0.949 0.943 0.936
Ensemble Norm 0.752 - - -
MFE -76.860 -91.373 -69.864 -64.189
Ligands - cobalamin cobalamin cobalamin
Gene LYSMD4 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 7. 6.001 11.
Length SE - 1. 0. 0.
Lev Distance - 63. 74. 80.
UBS 17. 18. 16. 17.
BS 0. 0. 0. 0.
ILL 6. 7. 4. 6.
ILR 3. 3. 3. 6.
H 4. 4. 5. 3.
BL 6. 5. 6. 6.
BR 5. 7. 5. 6.
UN 0.089 0.098 0.051 0.084

Sequences

Field Description
UTR seq + 25 guagccaauccgcaggcgcgguggcagcugcgggucgcgggucgcgggucgcgagucgccggucgccggucgcggcggagccugggcgcugagugaagaaaaugaggcacgaggaauuguuaaccaagaccuuccaaggcccagcuguugugugugggacuccgaccagccacguauacauguuuaagaATGTTCGTAGCCAATCCGCAGGCGC
UTR dot + 25 ………((((.(((.(((((((….((((.((((((……..)))))).))))..))))))))))))))(((((((((.((((..(((……..((.(((.(..((((..(((……))).))))..)))))))))…)))).)))).)))))…….(((…((((……..)))).))).(((……..)))..
RS 1 seq GCUUGAUAAGGGGGUCGUGGUCUGCGGGCGUUUCGCGCCCAAAGCUAAGAGGGAAGCCGGUGUGAAACCGGCGCUGCCCCCGCAACUGUAAGCGGCGAGCGGCCGUCCGAUACGUGUCACUGGGGCCCCGAACUCGAUUCGGCGGGGCGCCGGGAAGGCCAGGACGGCGGCGUCGACCCGCGAGCCAGGAGACCUGCCUCGACAGAUAACGUCCU
RS 1 dot ………((((((…(((..((.((..(((((((((….(((……..))).))))))))))).)))))))))))……….(((((((((.(((((((…..((.(..((((.((((((…(((…))))))))).))))..).))..))))))).)).)))..))))(((.((((…)))).)))(((…….)))..
RS 2 seq AUGGCAGCCAUGAAGACGGGUGCCCCUGCUGCCAGGGGAUAAUCGGGAAGUAUGGUAUGGCGCUUGCGCCUAUCCCAUCGCUGCCCCCGCAACGGUAAUGAGUGAGUCGCCUGCAACAACCACUGGCUUAGGCUGGGAAGGUGCAGGCAACGGCGUGAUCUCCUUGAUUGCGUCCUCCUCGAGCCCGGAGACCGGCCCGUUAUUUCGUUUCAUC
RS 2 dot ..(.((((((((….(.(((.((((((….))))))…))).)….)))))).)).)((((((((((.(((((…..(((………….(((((.(((.(……….).))).)))))))))))))))))))))))…(((((((((…..)))))))))((((……..))))…((..((……))..))…
RS 3 seq CACUUCACCCUUUUGUUAGGUGUCUCAAGUCCUUUCAAGACUCGAGAUGAAACGGGAAACCGGUGAGAUUAUUCAAUUCCGGUGCUGCCCCCGCAACGGUAAGCGAGGUGCACUGCUCAAUGCCACUGUGUUCAUGAACAUGGGAAGGCUGUAGUGCAAACGUGUCCACACGACGCUCGCAAGCCCGGAGACCGGCCUGACUACAUUGUGGCAA
RS 3 dot …((((((.(((((((…((((((.((((…….)))).)))))).)))))))….))))))………((((((.(((((….((..((((..(((.(.((((((((…..(((.(((((((….)))))))…))).))))))))..).)))..)).))..))..))).))))))))….(((..((……)))))..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table