Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA061393 Similarity: 0.989 Similarity: 0.988 Similarity: 0.988
UTR: 5HSAA061393
Gene: MAD2L1BP
MFE: -22.376
ENS: 0.973
Length: 61.
Predicted Ligands:
fluoride - 18/20
unknown - 1/20
cobalamin - 1/20
 RS: URS0000C492B4_1123069
MFE: -26.585
Ligand: fluoride
Species: Rubellimicrobium thermophilum DSM 16684 Fluoride riboswitch
 RS: URS0000E60499_1523413
MFE: -28.579
Ligand: unknown
Species: Novosphingobium sp. AAP1 nhaA-I RNA
 RS: URS0000D8F76F_1895815
MFE: -16.899
Ligand: fluoride
Species: Rhizobiales bacterium 65-79 Fluoride riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA061393 URS0000C492B4_1123069 URS0000E60499_1523413 URS0000D8F76F_1895815
Length 61. 61. 60. 61.
Similarity - 0.989 0.988 0.988
Ensemble Norm 0.973 - - -
MFE -22.376 -26.585 -28.579 -16.899
Ligands - fluoride unknown fluoride
Gene MAD2L1BP - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 2.002 3. 4.
Length SE - 0. 1. 0.
Lev Distance - 14. 14. 15.
UBS 6. 6. 5. 6.
BS 0. 0. 0. 0.
ILL 1. 0. 1. 0.
ILR 1. 1. 0. 2.
H 1. 1. 1. 1.
BL 3. 4. 2. 2.
BR 3. 3. 3. 2.
UN 0.131 0.082 0.117 0.131

Sequences

Field Description
UTR seq + 25 auucuaaccgcaaggaguagcggaggggaggucgugATGGCCCGCGTGCCGCTGGGGCGGA
UTR dot + 25 …….((((……(((((((.(.(.((((…..))))).).).))))))..)))).
RS 1 seq GUCCGCCCGCGGGAUGGGGCUUCCCGACAACCGCCUUGUGGCUGAUGGCUCCUGCUGCGGG
RS 1 dot …..(((((((.(.((((((((.(.((((…..)))).)..)).))))))).)))))))
RS 2 seq GGGUGCUCGCUGGCCAGAACGUGGUGCGGGCAGGCUUUUGCGCUGGUCGGGCCGCCAGCG
RS 2 dot …….(((((((……..(((.(((.(((((….)).))).))).))))))))))
RS 3 seq AUUUCACAUGGCGAUGGAGUUCGCCUUCGAGCGCCGAUCGGCUGAUGACUCCUUGACUGUC
RS 3 dot …….(((((((.((((((((((.(((…..)))..))).))..)))))))).)))).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table