Detected as a riboswitch by 3 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA061397 Similarity: 0.976 Similarity: 0.970 Similarity: 0.969
UTR: 5HSAA061397
Gene: MAD2L2
MFE: -36.576
ENS: 0.809
Length: 97.
Predicted Ligands:
TPP - 14/20
zmp-ztp - 2/20
GMP - 1/20
 RS: URS0000D289AE_1501240
MFE: -28.005
Ligand: TPP
Species: Palleronia abyssalis TPP
 RS: URS0000C6B4A5_1223545
MFE: -36.165
Ligand: TPP
Species: Gordonia soli NBRC 108243 TPP riboswitch (THI element)
 RS: URS000232C0B7_566461
MFE: -52.317
Ligand: zmp-ztp
Species: Streptomyces ghanaensis ATCC 14672 ZMP/ZTP riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA061397 URS0000D289AE_1501240 URS0000C6B4A5_1223545 URS000232C0B7_566461
Length 97. 98. 98. 99.
Similarity - 0.976 0.970 0.969
Ensemble Norm 0.809 - - -
MFE -36.576 -28.005 -36.165 -52.317
Ligands - TPP TPP zmp-ztp
Gene MAD2L2 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 7.002 7. 16.
Length SE - 1. 1. 4.
Lev Distance - 28. 36. 28.
UBS 12. 11. 10. 10.
BS 0. 0. 0. 0.
ILL 3. 2. 3. 1.
ILR 2. 3. 2. 0.
H 3. 3. 2. 3.
BL 3. 3. 2. 5.
BR 7. 5. 6. 7.
UN 0.031 0.071 0.010 0.030

Sequences

Field Description
UTR seq + 25 gcgcccgcgggagccgagcgcagccgagggcgagccgcggaacggggccggcguggagagguagcgggaaggATGACCACGCTCACACGACAAGACC
UTR dot + 25 .(((((.(((..((…..))..))).))))).(((.((…)).))).(((.((..(..((((((((……..)).)))).)).)..)).).))
RS 1 seq CCUCUCACCUCGGGGUGCCCAUGUGGCUGAGAUGCGAAAGCGAACCCGUUGAACCUGAUCCGGCUAACACCGGCGGAGGGAAGGUCGAACACCGGUCC
RS 1 dot ..(((((((.((((….)).)).)).))))).((….))..(((.(((..((((..(((.(((……))).).))..))))..)))…)))..
RS 2 seq GCGGUCCGACAGGGGUGCCGUCGUCAGACGGCUGAGAUCACACCCAUCGAACCUGCACCAGUUGGCACUGGCGAAGGGAACGUCGACCGCGGCCACGG
RS 2 dot (((((.(((…((((((((((….))))))………)))).))).))).)).((…((((..((((((.(….).))).)))..)))).))
RS 3 seq CCCGCGGGCCGUGACUGGCGCGCUGGGAUGGGACCGACCAUCGGGGAGCGGCCCCUGGGCACCGCCCAGCACCGAGUGCCGUGCGCCUGGGCCGUACCG
RS 3 dot ((.(((.((((….)))).))).))(((((……)))))..((.(((((((..((((((.((.(……..).)).)))).)).))))))).)).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table