Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA061402 Similarity: 0.974 Similarity: 0.973 Similarity: 0.973
UTR: 5HSAA061402
Gene: MAD2L2_0
MFE: -49.399
ENS: 0.985
Length: 110.
Predicted Ligands:
SAM - 10/20
TPP - 7/20
methionine - 2/20
 RS: URS0000AB296A_986075
MFE: -38.415
Ligand: SAM
Species: Caldalkalibacillus thermarum TA2.A1 SAM riboswitch (S box leader)
 RS: URS0000D8E7B2_1881060
MFE: -33.366
Ligand: SAM
Species: Clostridium sp. USBA 49 SAM riboswitch (S box leader)
 RS: URS0000D82AD3_1608910
MFE: -35.533
Ligand: SAM
Species: Bacillus sp. HMSC76G11 SAM riboswitch (S box leader)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA061402 URS0000AB296A_986075 URS0000D8E7B2_1881060 URS0000D82AD3_1608910
Length 110. 111. 111. 109.
Similarity - 0.974 0.973 0.973
Ensemble Norm 0.985 - - -
MFE -49.399 -38.415 -33.366 -35.533
Ligands - SAM SAM SAM
Gene MAD2L2 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 14. 21. 19.001
Length SE - 1. 1. 1.
Lev Distance - 28. 26. 27.
UBS 9. 8. 7. 9.
BS 0. 0. 0. 0.
ILL 4. 2. 1. 1.
ILR 2. 3. 2. 2.
H 3. 3. 3. 3.
BL 0. 2. 2. 3.
BR 4. 2. 2. 3.
UN 0.136 0.144 0.126 0.174

Sequences

Field Description
UTR seq + 25 gcgaucgguccggucgguggcuccccgcggcggggccgggcccgaucucgggcgggaaccgagcgcagagccgguagcgggaaggATGACCACGCTCACACGACAAGACC
UTR dot + 25 .((((((…))))))..(((((..(((..(((..((..(((((….))))).))..))).)))..))))).((((((((……..)).)))).))………..
RS 1 seq CUCUUAUCAAGAGAGGCGGAGGGACUGGCCCGAUGAAGCCCGGCAACCGCCAGCUCAGGCUGGAAAGGUGCCAAUUCCUGCGAAGAUGGUUCCAUCUUCGAGAGAUAAGAG
RS 1 dot (((((…..)))))….(((((.((((((..(..((((.(((……..)))..))))..)..)).)))).))))).((((((((….))))))))………..
RS 2 seq AUCUUAUCAAGAGAGGUGGAGGGACUGGCCCUAUGAAGCCCGGCAACCGGUAUUUUAAUACAAUGGUGCCAAUUCCUGCAGUAUUGCUUUUGCAAUACUGAAAGAUGAGGA
RS 2 dot (((((…….)))))..(((((.((((.(((((((..((((…))))..)))…….)))).)))).))))).(((((((((….)))))))))………..
RS 3 seq ACCUUAUCAAGAGAGGCGGAGGGACUUGGCCCGAUGAAGCCCGGCAACCGGUUGAUGCAACACGGUGCCAAUUCCAGCAGAGCAGGCAGACAGCUCUGGCAGAUAAGAA
RS 3 dot .((((…….))))…..(((.((((((((.((..((((((…))))…..))..))))).))))).)))..((((((.(…..).))))))………..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table