Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA061975 Similarity: 0.973 Similarity: 0.972 Similarity: 0.971
UTR: 5HSAA061975
Gene: MAGOHB
MFE: -34.595
ENS: 0.986
Length: 116.
Predicted Ligands:
TPP - 6/20
SAM - 5/20
Mn2+ - 3/20
 RS: URS0000C13766_1300342
MFE: -55.004
Ligand: Mn2+
Species: Dokdonella koreensis DS-123 yybP-ykoY manganese riboswitch
 RS: URS0000D7936C_1805029
MFE: -25.977
Ligand: tetrahydrofolate
Species: Candidatus Atribacteria bacterium CG2_30_33_13 THF riboswitch
 RS: URS0000D803B5_1943632
MFE: -46.241
Ligand: homocysteine
Species: Pseudomonas sp. Bc-h S-adenosyl-L-homocysteine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA061975 URS0000C13766_1300342 URS0000D7936C_1805029 URS0000D803B5_1943632
Length 116. 117. 116. 115.
Similarity - 0.973 0.972 0.971
Ensemble Norm 0.986 - - -
MFE -34.595 -55.004 -25.977 -46.241
Ligands - Mn2+ tetrahydrofolate homocysteine
Gene MAGOHB - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 4.001 4.005 4.
Length SE - 1. 0. 1.
Lev Distance - 34. 37. 36.
UBS 7. 7. 7. 8.
BS 0. 0. 0. 0.
ILL 3. 3. 2. 2.
ILR 1. 0. 2. 1.
H 3. 4. 3. 3.
BL 1. 0. 2. 2.
BR 1. 0. 0. 0.
UN 0.052 0.017 0.121 0.070

Sequences

Field Description
UTR seq + 25 guggugacgcacuuauuccgcgcgaugacgucacugcaaggcgccgggggacacguuggcugcguuuucggcgggcuucccggguacaaaaATGATCAGAAAAGAGGCTTATGTGC
UTR dot + 25 (((((((((…(((((……))))))))))))))……(((((((….(((.((((……)))).))))))))))(((((…….((……))……)))))
RS 1 seq CCGCGUCCCUUUGGGGAGUAGCCUGCAUCCCGCGGUCCCUGGGAUGCGCCCGCAUCAACACACUCGGCCUACAGCCGUGGUGCGGGCAGCCGAAUCCGGUUGGCGAGACCAACGGCC
RS 1 dot .((((((((…(((((…..((((…..)))))))))))))))))(((((((((…….((((…..)))))))))))))((((((….))))))((……….)).
RS 2 seq GUCAGAGUAGGUGAUAUGCGUUAAGUGUUAGAGAAUGGGACGUUGUCUCUAAACGAAAGGCUUAAAGAUUUAUCAAGAUAUUUUUAAGCUUGCGGUAUAUCAUCGCGUUCGCUGCU
RS 2 dot …….((((.((((.(((((..((……..))..)))))))))))))……((((((((((((……….))))))))))))(((((..((……))..))))).
RS 3 seq CUGUCCGAGGGGCGCUGCAGCAGGUCAGACCUGUCAGGCUCGGAUGGGGCGUUGUUUGCUCAAGGCUCUUCAGCAGCCUUAGCAAGCCUUAAACGCACAACGGCGCCCAUUCGCA
RS 3 dot ((((((((…((.(((..((((((…))))))))))))))))))).((((((((((((.((((((…….)))))))))))))….)))))……(((……))).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table