Detected as a riboswitch by 17 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA061997 Similarity: 0.989 Similarity: 0.987 Similarity: 0.986
UTR: 5HSAA061997
Gene: MAK16
MFE: -18.398
ENS: 0.920
Length: 65.
Predicted Ligands:
fluoride - 11/20
cobalamin - 4/20
guanine - 2/20
 RS: URS0002326A64_592678
MFE: -26.188
Ligand: cobalamin
Species: Amycolatopsis halophila YIM 93223 Cobalamin riboswitch
 RS: URS0000DB6973_243061
MFE: -25.125
Ligand: fluoride
Species: Mycobacterium sherrisii Fluoride riboswitch
 RS: URS00023151B0_1428628
MFE: -26.982
Ligand: fluoride
Species: Streptomyces mangrovisoli Fluoride riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA061997 URS0002326A64_592678 URS0000DB6973_243061 URS00023151B0_1428628
Length 65. 64. 65. 64.
Similarity - 0.989 0.987 0.986
Ensemble Norm 0.920 - - -
MFE -18.398 -26.188 -25.125 -26.982
Ligands - cobalamin fluoride fluoride
Gene MAK16 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3.004 11.009 6.
Length SE - 1. 0. 1.
Lev Distance - 12. 13. 15.
UBS 7. 7. 5. 6.
BS 0. 0. 0. 0.
ILL 2. 1. 1. 2.
ILR 2. 1. 1. 0.
H 1. 1. 1. 1.
BL 4. 4. 3. 3.
BR 4. 5. 2. 4.
UN 0.138 0.078 0.231 0.141

Sequences

Field Description
UTR seq + 25 cgcgauccgaccggaaguugcacgcugagccgcggacaccATGCAGTCGGATGATGTTATCTGGG
UTR dot + 25 ((..(((((((.(.(.(.((..(((……)))..)).).).).)))))))..))………
RS 1 seq GGAACCCGGUGCGAGUCCGGGGCGGUCCCGCCACUGUCACCUGCCGUGCGCAGGGAGCCAGAAC
RS 1 dot ((..(((.(((((.(.(.((((((((……)))))).)).).).))))).)))..))…..
RS 2 seq UUCGCGGUCGGCGAUGAGGCUCCGCCCGCUACGCGUCGCCCGACGCUGAUGGCUUCUACCCCGCA
RS 2 dot …((.(((((((.((.(((..(((…….)))..))))).))))))).))…………
RS 3 seq GGGAGCGCCGGUGAUGGGGCUCACCGCAACCGCGGAGGUGUCCGCUGACGGUCCCUGGUCCAGC
RS 3 dot ((((.((.(((((..((.(((..((((….)))).))).))))))).)).))))………

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table