Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA062297 Similarity: 0.985 Similarity: 0.984 Similarity: 0.983
UTR: 5HSAA062297
Gene: MAP2K4
MFE: -20.567
ENS: 0.987
Length: 80.
Predicted Ligands:
SAM - 7/20
fluoride - 4/20
cobalamin - 4/20
 RS: URS00007661C0_926571
MFE: -26.401
Ligand: fluoride
Species: Nitrososphaera viennensis EN76 Fluoride riboswitch
 RS: URS0000D6BBBE_12908
MFE: -23.248
Ligand: GMP
Species: unclassified sequences c-di-GMP-I-UAU riboswitch
 RS: URS0002318E2C_1618499
MFE: -13.903
Ligand: cobalamin
Species: Microgenomates group bacterium GW2011_GWA2_40_6 AdoCbl variant RNA
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA062297 URS00007661C0_926571 URS0000D6BBBE_12908 URS0002318E2C_1618499
Length 80. 82. 79. 79.
Similarity - 0.985 0.984 0.983
Ensemble Norm 0.987 - - -
MFE -20.567 -26.401 -23.248 -13.903
Ligands - fluoride GMP cobalamin
Gene MAP2K4 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3. 6.004 2.008
Length SE - 4. 1. 1.
Lev Distance - 15. 18. 21.
UBS 4. 5. 4. 4.
BS 0. 0. 0. 0.
ILL 1. 1. 1. 1.
ILR 0. 1. 2. 1.
H 2. 2. 2. 2.
BL 1. 1. 0. 1.
BR 1. 2. 0. 0.
UN 0.250 0.244 0.316 0.342

Sequences

Field Description
UTR seq + 25 agauguauaagaauaacagauauuuguuauuuuauagggugacuguuggaucuguATGGCGGCTCCGAGCCCGAGCGGCG
UTR dot + 25 ………((((((((((….))))))))))…((((…..(((((.((((…)))).)))))))))……..
RS 1 seq AAUAAUACAGGCUAUGGCAUUAGCCCUGGCGCAGGCCAAAACUGCCCUUUUGAAGAGAGGCGCGGAUAAUGCCUACUACUAC
RS 1 dot ……….((((.(((….))).))))..((((…..((((((((((…)))))).))))…..))))……..
RS 2 seq CAAGAAAAAUCCAAACCUGCUGUAAAGCAGGGACGGAAAGCCACGGGUUUCUUUUGUAAGAAGCAGCCGGUUAUCAAUA
RS 2 dot ………(((…((((((….))))))…)))……((((((((((….)))))))..)))……….
RS 3 seq AAGAAAAAUAGUUCAUUGGUGAAUUGGGUGUAAUUCCCAAACAGGGCCGCUACGGUUAUAGUCCGAACCCAAAAAUCUU
RS 3 dot ……………((((.((((((….))))))))))…(((……(((…….)))..)))………

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table