Detected as a riboswitch by 19 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA062370 Similarity: 0.983 Similarity: 0.981 Similarity: 0.979
UTR: 5HSAA062370
Gene: MAP3K3
MFE: -24.980
ENS: 0.933
Length: 89.
Predicted Ligands:
TPP - 11/20
cobalamin - 3/20
fluoride - 2/20
 RS: URS0000D97763_1803434
MFE: -30.967
Ligand: SAM
Species: Acidobacteria bacterium 13_1_20CM_4_56_7 SAM riboswitch (S box leader)
 RS: URS000232C37A_1869300
MFE: -27.320
Ligand: cobalamin
Species: Desulfobacterales bacterium S5133MH16 Cobalamin riboswitch
 RS: URS0000BED8D1_247156
MFE: -33.314
Ligand: fluoride
Species: Nocardia farcinica IFM 10152 Fluoride riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA062370 URS0000D97763_1803434 URS000232C37A_1869300 URS0000BED8D1_247156
Length 89. 90. 89. 90.
Similarity - 0.983 0.981 0.979
Ensemble Norm 0.933 - - -
MFE -24.980 -30.967 -27.320 -33.314
Ligands - SAM cobalamin fluoride
Gene MAP3K3 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 1.001 5.001 7.001
Length SE - 1. 0. 1.
Lev Distance - 22. 23. 24.
UBS 8. 8. 7. 9.
BS 0. 0. 0. 0.
ILL 0. 0. 0. 0.
ILR 3. 2. 1. 1.
H 2. 2. 2. 2.
BL 4. 4. 4. 5.
BR 3. 3. 3. 4.
UN 0.180 0.211 0.146 0.156

Sequences

Field Description
UTR seq + 25 guuuuucggagcguuccugaggugacacucacggaccuuagccaccgccgccgccaucgccaccATGGACGAACAGGAGGCATTGAACT
UTR dot + 25 ……(((.((((((.((((……)))).))))….))..)))..(((.((.((((((…))).)))…)).)))……..
RS 1 seq AUUUCAUGCAGAGUGGCUGAGGGACGAGCCCUGAGACGCCACGGCAACCGGACCGGGAUCAUCUAUCGCGGCCGCCAGGUGCCAACUCUC
RS 1 dot …………((((((.((((…..)))).)…)))))(((.(((((.(((.(((…..))).)))…)).))))))…….
RS 2 seq UGUUAACGCCACUGUAUUGAAGAAUCAGUAUGGGAAGGCAGCUAAAAGGGCGGGGGAGUCAGAAGACCUGCCAUUUUGUUUGGCAUUGG
RS 2 dot …….(((.(((((((((….)))))))))…))).((((((((((.((.((.(((….))))).)).)))).))))))…..
RS 3 seq GAGUCCGCAGGCGAUGGAUCUCCGCCGAGACGACCGACCUAUGGGCCGUCUGAACCGCCCCGGUCCGGGGCUGAUGGUUCCUUCCCCACG
RS 3 dot (.(((((.(((((.(.(.((((….))))).).)).))).))))))….(((((((((((…))))))….)))))……….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table