Detected as a riboswitch by 15 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA063192 Similarity: 0.971 Similarity: 0.971 Similarity: 0.970
UTR: 5HSAA063192
Gene: MAP7D3
MFE: -35.641
ENS: 0.888
Length: 116.
Predicted Ligands:
methionine - 10/20
TPP - 3/20
GMP - 2/20
 RS: URS0000D69BAB_12908
MFE: -33.344
Ligand: GMP
Species: unclassified sequences c-di-GMP-II-GAG riboswitch
 RS: URS0000BEC791_1571774
MFE: -46.864
Ligand: methionine
Species: Streptomyces sp. RSD-27 S-adenosyl methionine (SAM) riboswitch,
 RS: URS0000C38730_285458
MFE: -48.814
Ligand: methionine
Species: Streptomyces agglomeratus S-adenosyl methionine (SAM) riboswitch,
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA063192 URS0000D69BAB_12908 URS0000BEC791_1571774 URS0000C38730_285458
Length 116. 114. 117. 117.
Similarity - 0.971 0.971 0.970
Ensemble Norm 0.888 - - -
MFE -35.641 -33.344 -46.864 -48.814
Ligands - GMP methionine methionine
Gene MAP7D3 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 2. 5.001 1.001
Length SE - 4. 1. 1.
Lev Distance - 33. 36. 39.
UBS 10. 11. 10. 10.
BS 0. 0. 0. 0.
ILL 2. 3. 2. 1.
ILR 2. 2. 3. 2.
H 3. 3. 3. 3.
BL 4. 4. 4. 4.
BR 5. 5. 3. 5.
UN 0.129 0.123 0.103 0.103

Sequences

Field Description
UTR seq + 25 accggcagcccggccacgacccaagcggaggccgcgccgacgccugcgcaauguaugcggagagccaccaccgccuccggucccgacuccgATGACCAGCCCCCGAGTTGCTGCAG
UTR dot + 25 .((((….))))…………(((((((.(.(…..((((.((((…..)))).)).))…).).)))))))((..((((((.(………..).))))))..))..
RS 1 seq CCUCCGGGGGAAAGUAACGAUCCGAGCAGCCCACACCGACGCAUCCAUGCGCACGGAGACAGACGGUCGCCUAGGCGGCUCGGGGAGCGAGUGGCGAGACCGAACCCGCCCAGC
RS 1 dot (((….)))………..((((((.(((…((((.((..(((……..)))..).).))))……))).))))))((.(((.((..((….)).)).)))))…
RS 2 seq GGUCACGAGUGACAGCGUCAAGGCCCCGGCUCGCUGUCCGGCAACCCUCCUUCCGUGGCGGGGUGCCCCGGGUGAUGACCAGGUCGUAGGCAGCGAGGUCUACGGCAAGCGCGGAUC
RS 2 dot .((((….))))…((((..((((.(((.(.((((((((.((……))))).))))).).)))..))))..))))(..(((((((((……)))))))))..)……..
RS 3 seq GGUCAUGAGUGACAGCGUUUUGGCCCCGGCUUGCUGUCCGGCAACCCUCCGUCCGUGGCGGGGUGCCCCGGGUGAAGACCAGGUCGUGGACAGAAAGGUCCACGGCAAGCGCGGACC
RS 3 dot .((((….))))…(((((.((((.(((.(.(((((((((……..).))).))))).).)))..)))).)))))(..(((((((((……)))))))))..)……..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table