Detected as a riboswitch by 4 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA063259 Similarity: 0.982 Similarity: 0.980 Similarity: 0.979
UTR: 5HSAA063259
Gene: MAPK10
MFE: -14.478
ENS: 0.797
Length: 92.
Predicted Ligands:
TPP - 13/20
SAM - 3/20
glycine - 2/20
 RS: URS0000BF7108_1262970
MFE: -15.
Ligand: TPP
Species: Subdoligranulum sp. CAG:314 TPP riboswitch (THI element)
 RS: URS0000C6E2AA_864702
MFE: -26.107
Ligand: TPP
Species: Oscillatoriales cyanobacterium JSC-12 TPP riboswitch (THI element)
 RS: URS0000C07109_1089453
MFE: -24.359
Ligand: glycine
Species: Gordonia sputi NBRC 100414 Glycine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA063259 URS0000BF7108_1262970 URS0000C6E2AA_864702 URS0000C07109_1089453
Length 92. 91. 93. 92.
Similarity - 0.982 0.980 0.979
Ensemble Norm 0.797 - - -
MFE -14.478 -15. -26.107 -24.359
Ligands - TPP TPP glycine
Gene MAPK10 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 2. 0.001 6.002
Length SE - 1. 1. 0.
Lev Distance - 23. 26. 26.
UBS 5. 6. 5. 5.
BS 0. 0. 0. 2.
ILL 0. 0. 0. 1.
ILR 2. 2. 2. 2.
H 2. 2. 2. 2.
BL 1. 1. 1. 0.
BR 1. 2. 1. 1.
UN 0.141 0.154 0.118 0.098

Sequences

Field Description
UTR seq + 25 uuaugcaagaaacuguugaauuagacccguuuccuauagaugagaaaccauacaagcugugguauuuATGAGCCTCCATTTCTTATACTACT
UTR dot + 25 ……..(((((.(((……)))..)))))…((((((((((((((((…..))))))…………….))))))).)))..
RS 1 seq UUUAUACAAUCGGGGUGCUUUUAACGGCUGAGAUUAUACCCGUCGAACCUGUAAGGUAAUACUUGCGUAGGAAAAAUAUUUUUUCGGAUUU
RS 1 dot ……….(((((((.(((((…..))))).))).))))(((((((((((((……)))))..)))………..)))))….
RS 2 seq CAAACAAGCUAGGGGUGCCCUUUGGGGCUGAGAUUAAACCCUUAGAACCUGAGACCGGGUUAUACCGGCGGAGGGAAGCUGUUUAUCUGAGGA
RS 2 dot ……..(((((((((((……)))………))))))))..(((.(((((((……))))……………..))).))).
RS 3 seq CGCUGCAGUACGGGAGAGCGUCAUCUCGAAUGGCCGCCGAAGGAGCAACACCUCCUCGUCAAACUCUCAGGCACCCGGACCGUACUGUCGAC
RS 3 dot ((..(((((((((((((……))))…(((..((((((((((……)))))……….)).)))..)))..)))))))))))..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table