Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA063291 Similarity: 0.985 Similarity: 0.982 Similarity: 0.982
UTR: 5HSAA063291
Gene: MAPK15
MFE: -18.077
ENS: 0.970
Length: 66.
Predicted Ligands:
fluoride - 10/20
cobalamin - 5/20
unknown - 2/20
 RS: URS0000D8EEC1_1428626
MFE: -24.110
Ligand: fluoride
Species: Streptomyces malaysiense Fluoride riboswitch
 RS: URS0000D92544_1802174
MFE: -8.666
Ligand: fluoride
Species: Spirochaetes bacterium GWB1_36_13 Fluoride riboswitch
 RS: URS0000BFE868_1156913
MFE: -25.296
Ligand: cobalamin
Species: Amycolatopsis orientalis HCCB10007 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA063291 URS0000D8EEC1_1428626 URS0000D92544_1802174 URS0000BFE868_1156913
Length 66. 65. 65. 66.
Similarity - 0.985 0.982 0.982
Ensemble Norm 0.970 - - -
MFE -18.077 -24.110 -8.666 -25.296
Ligands - fluoride fluoride cobalamin
Gene MAPK15 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3. 3. 5.001
Length SE - 1. 1. 0.
Lev Distance - 18. 22. 23.
UBS 6. 6. 5. 5.
BS 0. 0. 0. 0.
ILL 1. 1. 2. 2.
ILR 2. 1. 2. 1.
H 2. 2. 1. 2.
BL 2. 1. 2. 1.
BR 2. 3. 2. 1.
UN 0.106 0.092 0.123 0.136

Sequences

Field Description
UTR seq + 25 aaccgacucaacaguaaggccccgcgggcguccuggccgccATGTGCACCGTAGTGGACCCTCGCA
UTR dot + 25 ..((.(((….)))..))….(((((.(((((((..((…..)).)))….)))).))))).
RS 1 seq GAACGCGCCGGUGAUGGGGCUCACCGCAACCGCGGCGACAUGCCGCUGACGGUCCCUGGUCGAAC
RS 1 dot ….((.(((….))).))((((((..(((((((((……))))).))))…)))).))..
RS 2 seq UUUUUAUUUGGAGAUGGAGUUCUCCCUUAAACCGUCCUGUAAAGACUGAUAACUCCUACUAAAAU
RS 2 dot ……(((((….((((((.((.(((..((……)).)))…)).))))))..)))))..
RS 3 seq GGGAAGCCGGUCGAAAUCCGGCGCUGUCGCGCAACCGUGGGCCCUCGCAGGGCAAGCCGGGAUACC
RS 3 dot …..(((((…….)))))..((((.((…..((..(((((…)))))..)))).))))..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table