Detected as a riboswitch by 2 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA063292 Similarity: 0.967 Similarity: 0.966 Similarity: 0.966
UTR: 5HSAA063292
Gene: MAPK15_0
MFE: -74.524
ENS: 0.831
Length: 144.
Predicted Ligands:
FMN - 9/20
SAM - 4/20
cobalamin - 4/20
 RS: URS0000DAD341_1904965
MFE: -59.438
Ligand: SAM
Species: Nocardiopsis sp. CNR-923 SAM riboswitch (S box leader)
 RS: URS0000C7BCCE_574376
MFE: -34.028
Ligand: SAM
Species: Bacillus sp. BL4-6 SAM riboswitch (S box leader)
 RS: URS0000AB433F_882378
MFE: -66.978
Ligand: glycine
Species: Burkholderia rhizoxinica HKI 454 Glycine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA063292 URS0000DAD341_1904965 URS0000C7BCCE_574376 URS0000AB433F_882378
Length 144. 143. 143. 144.
Similarity - 0.967 0.966 0.966
Ensemble Norm 0.831 - - -
MFE -74.524 -59.438 -34.028 -66.978
Ligands - SAM SAM glycine
Gene MAPK15 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 4.002 4.001 7.
Length SE - 1. 1. 0.
Lev Distance - 41. 42. 43.
UBS 11. 13. 12. 13.
BS 0. 0. 0. 0.
ILL 3. 3. 4. 4.
ILR 2. 2. 3. 2.
H 3. 3. 3. 3.
BL 3. 3. 3. 4.
BR 5. 5. 4. 6.
UN 0.056 0.105 0.091 0.042

Sequences

Field Description
UTR seq + 25 ccggggccugccgggggcgggggguguugggaggggcgccccgaggggcggggccgggccgccgucgguucccacggcaaccgacucaacaguaaggccccgcgggcguccuggccgccATGTGCACCGTAGTGGACCCTCGCA
UTR dot + 25 ((((.((((.(((….))).)))).))))..(((((((((……((((((((..((….(((((((((…)).)))))))……))..)))))))))))))))))((((((.(((…..))).)))).))……
RS 1 seq UGCUCAUCCAGAGGGGUGGAGGGACCGGCCCUACGAAGCCCCGGCAACCAUCUCAGCAUGCGAUACUCGCGCUCCUCGCGAGGCUGCUGGGGCAGGUGCCAACUCCGGCCUGGGGUCAAGGUGGCCACCAGGAAAGAUGAGGG
RS 1 dot ..(((((((….))))).))(((..((((((…..(((((((((.((.((.((((..((((…)))))))….).)))).)))))))))))).)))…)))..((((((((((…))))).)))))………..
RS 2 seq CUCUUAUCAAGAGCAGGUGGAGGGAUUUGGCCCGAUGAAACCCAGCAACCGACCGUAAUACCAUUGUGAAAUGGGGCGUGUUUACGCCUAGUAAGGCACGGUGCUAAUUCCAGCAGAAAGAAUAGCUUUCUGACAGAUAAGAG
RS 2 dot (((.((((…….)))))))(((.((((((((.((..((…((….((((((….(((((….))))).))).)))…))…))….))))).))))).)))..(((((((…..)))))))………..
RS 3 seq GCACCGCACUCUGGAGAGCGGUAGUAGCAGCCGUGCGCGUGCAAACGCAGCGGCGCAAGCUACCCACCGAAGGGGCGCGCGCCGAUGCGUGGCAGGCAAGCCGCGCGGCGCAAUCUCUCAGGUACCGAGGACAGAGGGGUCAUG
RS 3 dot (((((((.((….)).))))).)).((.(((((((((.(((..(((((.((((((..((..(((……)))..)))))))).))))).))).))…..))))))))).(((((((..((…….)).)))))))….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table