Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA063472 Similarity: 0.951 Similarity: 0.943 Similarity: 0.942
UTR: 5HSAA063472
Gene: MAPRE1
MFE: -55.496
ENS: 0.989
Length: 164.
Predicted Ligands:
cobalamin - 10/20
FMN - 6/20
guanidine - 1/20
 RS: URS0002333FF3_1660113
MFE: -65.395
Ligand: FMN
Species: Microbacterium sp. SCN 70-200 FMN riboswitch (RFN element)
 RS: URS000231D69B_1797289
MFE: -64.761
Ligand: cobalamin
Species: Armatimonadetes bacterium RBG_19FT_COMBO_69_19 Cobalamin riboswitch
 RS: URS0000D85FF7_40324
MFE: -63.543
Ligand: FMN
Species: Stenotrophomonas maltophilia FMN riboswitch (RFN element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA063472 URS0002333FF3_1660113 URS000231D69B_1797289 URS0000D85FF7_40324
Length 164. 164. 164. 163.
Similarity - 0.951 0.943 0.942
Ensemble Norm 0.989 - - -
MFE -55.496 -65.395 -64.761 -63.543
Ligands - FMN cobalamin FMN
Gene MAPRE1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 7.002 30.003 40.
Length SE - 0. 0. 1.
Lev Distance - 61. 57. 50.
UBS 17. 16. 14. 14.
BS 0. 0. 0. 1.
ILL 5. 4. 3. 4.
ILR 4. 2. 4. 4.
H 3. 3. 3. 3.
BL 6. 6. 5. 4.
BR 10. 9. 6. 5.
UN 0.073 0.024 0.128 0.074

Sequences

Field Description
UTR seq + 25 cuuuacgucggcgcguaacgagggggugcgugugaggucaucgcgcgggcgggcgggcggggucuggcgguuugaacgagacgaagacggaaccggagccgguugcgggcaguggacgcgguucugccgagagccgaagATGGCAGTGAACGTATACTCAACGT
UTR dot + 25 …..((((.((.(((..((..(.(((((…….).)))).).)).))).)).))))((.((((((.((((………..)))).)..))))).))(..((((..((.((..(((((((((….)))))))….)).)).))..))))..)…….
RS 1 seq AACGUGCUCCGGGGUCGGUGUGAAUCCGAACCGGCGGUGACAGUCCGCGAGCCCGCGCGGUCGGCAACGAUUGCGAGGGUUGACCUGGUGGAAUUCCGGGACCGACGGUGAUGCGACGCAACUCGAAUGGGUUGAUCGCUAGUCCGGAUGGGAGGCAGCACGAG
RS 1 dot …(((((((((..((((…….)))).)))).))).)).(((….(((((.((((((((….)))))))).))))))))((.(((…((((.(..(.(((((((((.((((.((…….)).)))))))))).))).)..).))))….))).))
RS 2 seq UACGAUCUCACGGGUGCAGGUGGAGGGAAGUCCGGUGCGAUUCCGGCGCGGUCCCGCCGCUGUCACCGGUAAGGAUCCCCGAUCAGGCCACUGGGUUCGUCCGGGAAGGCCGGGGACUCCGAUGAACCGGGAGCCAGAAGACCUGCCUGCCCCACUCGCCACAC
RS 2 dot ………((.((((..(((((.((((.((((((…….)))).))..)))).)))))..)))).))..((((((((…..((((.((((……))))…))))))))).)))…((…(((((.(((…..))).)).)))…))…….
RS 3 seq AAACGUCUUCAGGGCGGGGUGCAAUUCCCCACCGGCGGUAGGGGUGCAAGCCCGAGCCCGCGAGCGCUUUGUCCAUCUGUCCUCCAGAUAGAUGCGUUGAAGGUCAGCAGAUCCGGUCAGAUGCCGGAGCCGACGGUCAUAGUCCGGAUGAAAGAAGACGGUG
RS 3 dot …(((((((.((((.(((((((…(((((((…))).)))))))..))))..))))((..((.((((..(((((((((…..)))))))).)..))))))..))..((((((.(..((((((…….))).))).).))))))….)))))))…

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table