Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA063479 Similarity: 0.945 Similarity: 0.943 Similarity: 0.943
UTR: 5HSAA063479
Gene: MAPRE1_0
MFE: -58.246
ENS: 0.989
Length: 161.
Predicted Ligands:
FMN - 9/20
cobalamin - 6/20
glucosamine - 3/20
RS: URS0000DB4B5C_2734
MFE: -67.343
Ligand: glucosamine
Species: Symbiobacterium thermophilum glmS glucosamine-6-phosphate activated ribozyme
RS: URS000232EB44_545694
MFE: -50.966
Ligand: cobalamin
Species: Treponema primitia ZAS-2 Cobalamin riboswitch
RS: URS0002333FF3_1660113
MFE: -65.395
Ligand: FMN
Species: Microbacterium sp. SCN 70-200 FMN riboswitch (RFN element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA063479 URS0000DB4B5C_2734 URS000232EB44_545694 URS0002333FF3_1660113
Length 161. 160. 160. 164.
Similarity - 0.945 0.943 0.943
Ensemble Norm 0.989 - - -
MFE -58.246 -67.343 -50.966 -65.395
Ligands - glucosamine cobalamin FMN
Gene MAPRE1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 15.005 21. 7.003
Length SE - 1. 1. 9.
Lev Distance - 63. 61. 60.
UBS 17. 16. 14. 16.
BS 0. 0. 0. 0.
ILL 5. 3. 4. 4.
ILR 3. 3. 3. 2.
H 3. 3. 2. 3.
BL 6. 7. 5. 6.
BR 11. 8. 8. 9.
UN 0.075 0.006 0.094 0.024

Sequences

Field Description
UTR seq + 25 cuuuacgucggcgcguaacgagggggugcgugugaggucaucgcgcgggcgggcgggcggggucuggcgguuugaacgagacgaagacggaaccggagccgguugcgggcaguggacgcgguucugccgagagccgATGGCAGTGAACGTATACTCAACGT
UTR dot + 25 …..((((.((.(((..((..(.(((((…….).)))).).)).))).)).))))((.((((((.((((………..)))).)..))))).))(..((((..((.((..(((((((((….))))))).)).)).))..))))..)…….
RS 1 seq CGGAUUGUUGAAGCGCCAGGACUUGUGGCCUUCGGGGCCGCAAGUUGACGAGGUGGGGGAUCUCGGAGGAUUCGGCGGGUGACCCCCGGUUGCUCACGACCGACAGCGGCUCUACAAAGGCCGGGAGCGAUCCCGGAGACAAAGGGGCCAGGUGAGGCCG
RS 1 dot ((((((.((….((((.(((((((((((((…))))))))))))..)..)))))).)))).))(((.(.((((.(((…))))))).).))).((.((..((.(((((((…….((((((….))))))…….)))))).).)).)).))
RS 2 seq AAAGGAAGGGAGGUGAUCGGUAUUGACUGAGAUUCCUCCGCUAUCCCGUAACUGUGAGUGGGUUUUCCAUCAUUAACGGUCACUGGCCAGACUAAAAUCCGACUGGGAAGGCCGAUGGAAAUGUCCGGUGAGUAGCCGGAGCCCAUAAGCCAGGAGACUU
RS 2 dot …((((((((((.(.(((((….)))))..).))))).)).)))…..((((..((((((((………..((((.(((.(((.(((…..((((..(((…..))).))))…))).))).))).))))))))))))..).)))…….
RS 3 seq AACGUGCUCCGGGGUCGGUGUGAAUCCGAACCGGCGGUGACAGUCCGCGAGCCCGCGCGGUCGGCAACGAUUGCGAGGGUUGACCUGGUGGAAUUCCGGGACCGACGGUGAUGCGACGCAACUCGAAUGGGUUGAUCGCUAGUCCGGAUGGGAGGCAGCACGAG
RS 3 dot …(((((((((..((((…….)))).)))).))).)).(((….(((((.((((((((….)))))))).))))))))((.(((…((((.(..(.(((((((((.((((.((…….)).)))))))))).))).)..).))))….))).))

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table