Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA063487 Similarity: 0.986 Similarity: 0.984 Similarity: 0.983
UTR: 5HSAA063487
Gene: MAPRE1_1
MFE: -23.760
ENS: 0.950
Length: 71.
Predicted Ligands:
cobalamin - 6/20
homocysteine - 4/20
SAM - 3/20
 RS: URS0000BE60FD_1179773
MFE: -30.278
Ligand: cobalamin
Species: Saccharothrix espanaensis DSM 44229 Cobalamin riboswitch
 RS: URS0000C543C7_477245
MFE: -30.458
Ligand: cobalamin
Species: Streptomyces cyaneogriseus subsp. noncyanogenus Cobalamin riboswitch
 RS: URS0000DB4325_56427
MFE: -27.779
Ligand: cobalamin
Species: Couchioplanes caeruleus subsp. caeruleus Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA063487 URS0000BE60FD_1179773 URS0000C543C7_477245 URS0000DB4325_56427
Length 71. 71. 70. 71.
Similarity - 0.986 0.984 0.983
Ensemble Norm 0.950 - - -
MFE -23.760 -30.278 -30.458 -27.779
Ligands - cobalamin cobalamin cobalamin
Gene MAPRE1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 9.001 2.001 2.003
Length SE - 0. 1. 0.
Lev Distance - 16. 20. 22.
UBS 6. 6. 6. 7.
BS 0. 0. 0. 0.
ILL 1. 2. 1. 2.
ILR 2. 0. 1. 2.
H 2. 2. 2. 2.
BL 2. 0. 1. 2.
BR 2. 2. 2. 2.
UN 0.085 0.056 0.114 0.028

Sequences

Field Description
UTR seq + 25 ggcugcugcuacgcgggguggggguuucugggccgccgcugagaagATGGCAGTGAACGTATACTCAACGT
UTR dot + 25 ….((((((((.(..(((((.((((….)))).)))))..)..).)))))))..((((…….))))
RS 1 seq GAGGAAGCCGGUGCGAAUCCGGCACGGUCCCGCCACUGUGACCGGGCACCAGGCCCGGGAGUCAGGAACUC
RS 1 dot ..((..((((((((….((((((((((……)))))).))))))))).)))))..((((…..))))
RS 2 seq GGGGAAGCCGGUGCAAUUCCGGCGCUGACCCGCAGCCGUGAGCCGCCCGGGGCGGUGAGCCGGAUCGCCC
RS 2 dot ……..(((.((..(((((((((……)).)))).)))..)))))(((((((…….)))))))
RS 3 seq GAGGAAGCCGGUGCGAGUCCGGCGCGGUCCCGCCACUGUCACCGGGUUUCGAGCCCGGGAGCCAGGAACUC
RS 3 dot ..((((.((((((..(((..((((……)))))))..)))))).))))(((((.((…)).))..)))

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table