Detected as a riboswitch by 14 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA063490 Similarity: 0.975 Similarity: 0.975 Similarity: 0.973
UTR: 5HSAA063490
Gene: MAPRE1_2
MFE: -42.151
ENS: 0.872
Length: 113.
Predicted Ligands:
glycine - 6/20
guanidine - 6/20
SAM - 4/20
 RS: URS0000AB203E_713604
MFE: -42.658
Ligand: glycine
Species: Amycolatopsis mediterranei S699 Glycine riboswitch
 RS: URS0000C3D7EE_990271
MFE: -28.599
Ligand: glycine
Species: Vibrio variabilis Glycine riboswitch
 RS: URS0000563A81_316275
MFE: -27.080
Ligand: glycine
Species: Aliivibrio salmonicida LFI1238 gcvT riboswitch element
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA063490 URS0000AB203E_713604 URS0000C3D7EE_990271 URS0000563A81_316275
Length 113. 113. 112. 113.
Similarity - 0.975 0.975 0.973
Ensemble Norm 0.872 - - -
MFE -42.151 -42.658 -28.599 -27.080
Ligands - glycine glycine glycine
Gene MAPRE1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 6.001 9. 8.004
Length SE - 0. 1. 0.
Lev Distance - 32. 30. 33.
UBS 6. 7. 8. 6.
BS 0. 0. 0. 1.
ILL 0. 2. 2. 1.
ILR 1. 1. 2. 2.
H 3. 3. 3. 3.
BL 3. 2. 3. 1.
BR 2. 2. 2. 1.
UN 0.133 0.168 0.116 0.195

Sequences

Field Description
UTR seq + 25 uucugggccgccgcugagguguggucccugcgcugcagcgacuggaggucccagggugguugggcccugggagggugugggcgagaagATGGCAGTGAACGTATACTCAACGT
UTR dot + 25 …….(((.(((((.(((((((…))))))).)))))..)))…(((((((((……)))))))))(((((((.(………………).)))))))…..
RS 1 seq CGAGGCCACUCUGGAAAGCAGGCGCACCCGCGCCUCACCCAAGGUGAAAGCCGUGCUGUGUCUUCUCCCAGCGGCACGGUGAAACUCUCAGGUGCCAUGACAGAGGGGGAGUU
RS 1 dot ……((((.(((…(.((((((….)))))))..))).))))…((((((((((………..))))))))))….(((((..((……)).)))))……
RS 2 seq GGAGGAACCUCUGGAGAGAAUCGCACUACUUUUGUAGAUAGCGGUCGCCGAAGGAGCAAGCUCAUUUCUAAUGAUGAGUGAAACUCUCAGGCAAAAGGACAGAGGAGAGAAU
RS 2 dot ….(..(((.(((.((…((((.((((….))))…)))))).))).)))..)..(((((((……)))))))….(((((…………….)))))…
RS 3 seq AUGAAGACUGCAGGAGAGCGGCAACGCCAUUAUUUGGCAACGCCCACCGAAGAAGUAAAUCUUUCAGGUGCCUAAUUCAAAACCAUGAAUAAGGUGAGGACUGUAGUUGGAGG
RS 3 dot …..((((((((……(((…((((…..))))…)))(((((((((……)))))..))))(((.(((((……))))).)))……))))))))…..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table