Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA063581 Similarity: 0.984 Similarity: 0.984 Similarity: 0.983
UTR: 5HSAA063581
Gene: MARK1
MFE: -12.858
ENS: 0.998
Length: 74.
Predicted Ligands:
fluoride - 16/20
GMP - 2/20
SAM - 1/20
 RS: URS0000C23CFC_1423739
MFE: -15.395
Ligand: fluoride
Species: Lactobacillus diolivorans DSM 14421 Fluoride riboswitch
 RS: URS0000DAE31D_1986778
MFE: -17.125
Ligand: SAM
Species: bacterium TMED144 SAM riboswitch (alpha-proteobacteria)
 RS: URS0000D893CD_1797850
MFE: -18.721
Ligand: fluoride
Species: Deltaproteobacteria bacterium RBG_19FT_COMBO_46_12 Fluoride riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA063581 URS0000C23CFC_1423739 URS0000DAE31D_1986778 URS0000D893CD_1797850
Length 74. 75. 74. 73.
Similarity - 0.984 0.984 0.983
Ensemble Norm 0.998 - - -
MFE -12.858 -15.395 -17.125 -18.721
Ligands - fluoride SAM fluoride
Gene MARK1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 4.004 0.018 2.018
Length SE - 1. 0. 1.
Lev Distance - 19. 22. 21.
UBS 4. 4. 4. 5.
BS 0. 0. 0. 0.
ILL 1. 0. 1. 1.
ILR 1. 0. 1. 1.
H 3. 3. 3. 3.
BL 0. 1. 0. 0.
BR 0. 1. 0. 1.
UN 0.284 0.347 0.149 0.151

Sequences

Field Description
UTR seq + 25 aaauauaucuaccuguuuucuuuaacaguuauuucgagaaguacgaauaATGTCGGCCCGGACGCCATTGCCGA
UTR dot + 25 …………(((((……)))))….((((…….))))…..(((((..((…))…)))))
RS 1 seq UAUUAAAACGGCGAUGACGUUCGCCCUUACUCAGCAGUGUUAACACACCAAAGAGUUGAUGACGUCUACUUUAAC
RS 1 dot ………(((((……)))))………..((((….))))…(((((.(((…))).)))))…
RS 2 seq AAUUUUGAUGGUCGAGAUUUGACCGUAUUGCAUCGACGUAAAACAAAUGCUAAAAAGGCAUAGCCUCUGCAUUU
RS 2 dot …….((((((((…)))))))).((((……))))…((((((…..((((…))))..))))))
RS 3 seq AUCAAUCUCGGUGAUGAAGUUCGCCAUUAACCGCUCCCCCCUUUUAUCGGGGGCUGAUAACUUCUACUAGUUU
RS 3 dot ……..((((((((……..))))).)))(..(((((…….)))))..)..((((……)))).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table