Detected as a riboswitch by 1 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA063838 Similarity: 0.959 Similarity: 0.957 Similarity: 0.956
UTR: 5HSAA063838
Gene: MAT2A
MFE: -38.978
ENS: 0.790
Length: 148.
Predicted Ligands:
cobalamin - 10/20
FMN - 5/20
glucosamine - 3/20
 RS: URS0000BF8A45_1262827
MFE: -24.494
Ligand: glucosamine
Species: Clostridium sp. CAG:609 glmS glucosamine-6-phosphate activated ribozyme
 RS: URS0002314ABF_1797659
MFE: -64.088
Ligand: cobalamin
Species: Chloroflexi bacterium RBG_16_64_43 Cobalamin riboswitch
 RS: URS0002329059_1802176
MFE: -48.989
Ligand: cobalamin
Species: Spirochaetes bacterium GWB1_59_5 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA063838 URS0000BF8A45_1262827 URS0002314ABF_1797659 URS0002329059_1802176
Length 148. 146. 149. 147.
Similarity - 0.959 0.957 0.956
Ensemble Norm 0.790 - - -
MFE -38.978 -24.494 -64.088 -48.989
Ligands - glucosamine cobalamin cobalamin
Gene MAT2A - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 14. 11.006 4.
Length SE - 4. 1. 1.
Lev Distance - 43. 52. 56.
UBS 11. 9. 10. 12.
BS 0. 0. 1. 0.
ILL 2. 2. 3. 3.
ILR 5. 2. 3. 6.
H 3. 4. 3. 3.
BL 2. 2. 2. 2.
BR 2. 2. 4. 3.
UN 0.088 0.110 0.168 0.102

Sequences

Field Description
UTR seq + 25 uucguucgcuccgcgccgcccgccugcuacgaguagaacgcuguccgcagcuugcgcauuucgcagccgcugccgccucgccgcugcuccuucguaaggccacuuccgcacaccgacaccaacATGAACGGACAGCTCAACGGCTTCC
UTR dot + 25 ..(((((((((.((((…..))..))…)))).)))))……((((((((((…..)))))..))))).(((…..((((.((((((((..((……………….))…))))).)))))))…..)))….
RS 1 seq AAUUGUUUGUUAGCGCCAGACCCACGUGGUUAACGAGGAUGAUGAUUAUCGAUAUUUCGGCGGAUACAUCACGGGCUAGUAUACUCGAAAGAUAUAUAAUAAAAAUCAAAAUCAAAAUUGUAACAAAAAAUAUAUCACAUACUUUA
RS 1 dot …(.(((((((..((((……..))))))))))).)((((((((.((((….))))..))).)))))((((……..))))…(((((((………(((……..)))………)))))))……….
RS 2 seq ACUUAGUCCUGCGGCCGAGGUUCCCUGUUCCCCCGGAUGGGAGGGAUCAAAGGCGAAGCCGGUGCAAGUCCGGCGCUGCCGCGCAACUGUGAGCCCAGGGCGUUGAGCCCUUGGCAAGCCAGGUCGCCCGCCUCGGUCGCGUUCCCAAA
RS 2 dot ………((((((((((((….((.((((((…..)).)))).))..((((..(((((…….)))))..))))(((…((((..(((.(((((…..))))).)))..)).))..)))..))))))))))))……..
RS 3 seq GAUCCCUGACGAUCCUAUAGUGCCUUUGUACGCAGCGAUGACGAGGGGGAAUCCGGUGAGAUGCCGGAGCUAGCCCGUAACUGUAUGCGGUUUCACCCCAAGGGUGGAACGGCGAGCCAGGUUACCUUCUUCAGCCGCUAUUUUCGU
RS 3 dot ..(((((..(((((((…((((….))))..)).)))..))..))))).((((((…..))))))(((((…((((((((.(((.(((((((((…))))))))).))).))..))))))…))..)))…………

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table