Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA064051 Similarity: 0.953 Similarity: 0.953 Similarity: 0.952
UTR: 5HSAA064051
Gene: MBD2
MFE: -14.386
ENS: 0.999
Length: 147.
Predicted Ligands:
cobalamin - 9/20
glucosamine - 6/20
FMN - 3/20
RS: URS0000D6A3C5_12908
MFE: -30.985
Ligand: Ni/Co
Species: unclassified sequences NiCo riboswitch
RS: URS0000C47321_1316414
MFE: -33.882
Ligand: glucosamine
Species: Enterococcus sp. HSIEG1 glmS glucosamine-6-phosphate activated ribozyme
RS: URS00023154D8_2018041
MFE: -47.798
Ligand: cobalamin
Species: Rhodococcus sp. 1168 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA064051 URS0000D6A3C5_12908 URS0000C47321_1316414 URS00023154D8_2018041
Length 147. 147. 147. 145.
Similarity - 0.953 0.953 0.952
Ensemble Norm 0.999 - - -
MFE -14.386 -30.985 -33.882 -47.798
Ligands - Ni/Co glucosamine cobalamin
Gene MBD2 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3. 3.002 5.006
Length SE - 0. 0. 4.
Lev Distance - 63. 63. 57.
UBS 8. 9. 9. 7.
BS 0. 0. 0. 0.
ILL 4. 4. 4. 2.
ILR 3. 2. 3. 3.
H 3. 4. 4. 3.
BL 0. 0. 1. 0.
BR 1. 1. 1. 1.
UN 0.129 0.116 0.177 0.207

Sequences

Field Description
UTR seq + 25 ggguaaaccagacuugaauacaacauugccaauuagacaaacagcaucaauuuucaaacaaccgguaaccaaagucacaaaucauccuaguaauaaagugaaaucagacccacaacgaaugaATGCGCGCGCACCCGGGGGGAGGCC
UTR dot + 25 .(((((……………….)))))………….((((((…(((……..(((……..((((……………….))))……)))……)))))).)))….((..((….))..)).
RS 1 seq ACAGUACAAACUGAACAGGCCGAUAGGAGCCGGGUCACAUUAGUGACAGUGGAUUAUUAUGUUUUUUAUGUAUUUAUAUACAAUAUGAGAUUUAUCAUAUAUCGUCAAAUGAUUGGUGAUAGAAAUUAUCAUAUCCACGGGACAGUA
RS 1 dot .((((….))))….((((…..).)))..(((((….))))).(((((….((((…………………..((((..((((((((..(((((…)))))..))))))))..)))))))))))))………
RS 2 seq CCAAUAGGAAUAGCGCCAGAUCUGUACAACAGAUGACGAGGAGAGAGUUUAUCGAAGUUUUCGGCGGGUAACUCUAGGGACUGCACUCUAUAAGCAAGAACAAAACCUCAUCGUGAGAUGAAAACAAACCUCUUGCUGCGCAGGUAG
RS 2 dot ……((…….))..((((((…))))))………((((((..(((..(….)..)))..))))))…..((((.(……(((((((……..(((((….)))))………)))))))).))))….
RS 3 seq AAGGUCGAACGACGGUAGGGUUCGACCAACGGAGCUGAUGCGGGGAAGUCCUGUGUGAUUCAGGCGCGGUCCCGCCACUGUGUACGAGUAUUCCGAUUGUCGGCAGCCUCGUAAGCCAGAUCACCGCACAGCAUCGAAAUUACUU
RS 3 dot ..((((((((………))))))))…………((((((..((((((…….)))).))..))))))..(((((((((((….((((…))))….)))))………….))))))…………..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table