Detected as a riboswitch by 1 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA064072 Similarity: 0.986 Similarity: 0.986 Similarity: 0.985
UTR: 5HSAA064072
Gene: MBIP
MFE: -24.301
ENS: 0.618
Length: 76.
Predicted Ligands:
SAM - 12/20
fluoride - 3/20
homocysteine - 2/20
 RS: URS0000DB4B1C_505252
MFE: -22.644
Ligand: SAM
Species: Marivita cryptomonadis SAM riboswitch (alpha-proteobacteria)
 RS: URS0000D80070_1122209
MFE: -25.899
Ligand: homocysteine
Species: Marinospirillum alkaliphilum DSM 21637 S-adenosyl-L-homocysteine riboswitch
 RS: URS0000BEA51E_1703357
MFE: -19.738
Ligand: SAM
Species: Gemmatimonas sp. SG8_28 SAM riboswitch (alpha-proteobacteria)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA064072 URS0000DB4B1C_505252 URS0000D80070_1122209 URS0000BEA51E_1703357
Length 76. 77. 76. 76.
Similarity - 0.986 0.986 0.985
Ensemble Norm 0.618 - - -
MFE -24.301 -22.644 -25.899 -19.738
Ligands - SAM homocysteine SAM
Gene MBIP - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 10. 4.003 5.003
Length SE - 1. 0. 0.
Lev Distance - 14. 18. 19.
UBS 5. 7. 5. 5.
BS 0. 0. 0. 0.
ILL 1. 1. 2. 1.
ILR 1. 2. 2. 3.
H 1. 1. 1. 1.
BL 1. 3. 2. 1.
BR 2. 3. 1. 1.
UN 0.079 0.091 0.026 0.132

Sequences

Field Description
UTR seq + 25 uugugagcaaaucuugguggugguggugguggggcggccugagaagauauuATGGCTGCTGCCACGGAGCTTAATC
UTR dot + 25 …(((((…(((((((((((((.((((((((….)))……..))))).)))))))))).))))))))…
RS 1 seq CUGCGGCUUUGUGGCGAUUUGUUACCGGAUUGCGGGCCACGUUAAACAUGCCGCUAAAAGGUCAGCCGAAAGCCCCU
RS 1 dot ….((((((.(((((((((.(((.(((..((((…..))…..))..))).))).))))).))))))))))…
RS 2 seq UGAACUGAGGGGCGCUGCAGCAGCUUUUACUGUCAGGCUCAGUUCAGGAAACACUGUUCAACGGCGCCCGUUCAAC
RS 2 dot (((((….((((((((.(((((..(((.(((…………))).)))..)))))…)))))))))))))..
RS 3 seq AUCGAUCGUCGUGGUGAUUUGCGGCCUAUUGCAGCCACGUAAAACAAGUCGCUAAAAAGCUCGCCCUCGGCGCUUU
RS 3 dot ……(((((.(((((((((((((…((((……))))…..))))).)))….)))))..)))))….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table