Detected as a riboswitch by 1 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA064073 Similarity: 0.978 Similarity: 0.976 Similarity: 0.976
UTR: 5HSAA064073
Gene: MBIP_0
MFE: -36.049
ENS: 0.755
Length: 113.
Predicted Ligands:
TPP - 15/20
cobalamin - 1/20
SAM - 1/20
 RS: URS0000C6947B_768710
MFE: -29.343
Ligand: TPP
Species: Desulfosporosinus youngiae DSM 17734 TPP riboswitch (THI element)
 RS: URS0000DB405F_2030
MFE: -44.920
Ligand: TPP
Species: Kibdelosporangium aridum TPP riboswitch (THI element)
 RS: URS0000AB697F_351607
MFE: -51.664
Ligand: TPP
Species: Acidothermus cellulolyticus 11B TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA064073 URS0000C6947B_768710 URS0000DB405F_2030 URS0000AB697F_351607
Length 113. 112. 114. 113.
Similarity - 0.978 0.976 0.976
Ensemble Norm 0.755 - - -
MFE -36.049 -29.343 -44.920 -51.664
Ligands - TPP TPP TPP
Gene MBIP - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 2.007 6. 15.001
Length SE - 1. 1. 0.
Lev Distance - 28. 29. 27.
UBS 8. 8. 8. 10.
BS 0. 0. 0. 0.
ILL 3. 3. 4. 2.
ILR 2. 2. 3. 2.
H 2. 2. 2. 2.
BL 1. 2. 1. 4.
BR 3. 4. 1. 4.
UN 0.062 0.143 0.070 0.088

Sequences

Field Description
UTR seq + 25 ucgccaagcgacuaaagcuggaagggagggggcgggguugugagcaaaucuugguggugguggugguggggcggccugagaagauaucATGGCTGCTGCCACGGAGCTTAATC
UTR dot + 25 .((((((((((((…(((………..)))..)))))………)))))))((..(.(((((..((((((((((…….))).)))))))))))).).))……
RS 1 seq AAUAGUUCCUGGGGGUGCCGAAAAGGUCGGCUGAGAUUAAGGACUGAUGAAUCCUUUGACCCUUUAACCUGAUCUGGGUAAUGCCAGCGUAGGGAAGGUGGACAGAUAGCGU
RS 1 dot ..((((((.(((….(((((…..)))))…..))).))))))……..((((.((((((..((((..((((……))))..)))).)))).)).))))……
RS 2 seq CGGUUCUGCCACGGGAGUCCGGUGCAACCGGGCUGAGAGGAGGGCGAACCAGCCCUCGACCGUAUGAACCUGAUCCGGGUCAUGCCGGCGCAGGGACGGGAGGAACGCACAGUG
RS 2 dot .(((((.(((…..((((((((…))))))))……..)))))))).((((((..((((…..((((..((((……))))..)))).))))))))…))……
RS 3 seq UGGGGUCGGCGCGGGAGCCCGGGGCACCGGGCUGAGAGGGCAGCUGACGCCGCUGCCGACCGUGGAACCUGCUCCGGGUCAUGCCGGCGAAGGGAGGCUGCGUGGGUCACCGU
RS 3 dot .((.((((((((…(((((((….)))))))……)).)))))).))…(((.(.(((((..(((.((((((……))))….)).))))))))).)))……

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table