Detected as a riboswitch by 14 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA064122 Similarity: 0.983 Similarity: 0.983 Similarity: 0.982
UTR: 5HSAA064122
Gene: MBOAT1
MFE: -21.972
ENS: 0.891
Length: 88.
Predicted Ligands:
SAM - 16/20
glycine - 3/20
Ni/Co - 1/20
RS: URS0000D65731_12908
MFE: -15.585
Ligand: SAM
Species: unclassified sequences SAM-I/IV variant riboswitch
RS: URS0000D69652_12908
MFE: -15.135
Ligand: SAM
Species: unclassified sequences SAM-I/IV variant riboswitch
RS: URS0000D66E7D_12908
MFE: -18.015
Ligand: SAM
Species: unclassified sequences SAM-I/IV variant riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA064122 URS0000D65731_12908 URS0000D69652_12908 URS0000D66E7D_12908
Length 88. 89. 88. 87.
Similarity - 0.983 0.983 0.982
Ensemble Norm 0.891 - - -
MFE -21.972 -15.585 -15.135 -18.015
Ligands - SAM SAM SAM
Gene MBOAT1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 2.003 2.003 2.002
Length SE - 1. 0. 1.
Lev Distance - 21. 23. 22.
UBS 5. 6. 6. 6.
BS 0. 0. 0. 0.
ILL 0. 0. 0. 0.
ILR 0. 0. 0. 0.
H 3. 3. 3. 3.
BL 1. 2. 2. 2.
BR 2. 2. 2. 2.
UN 0.227 0.281 0.284 0.276

Sequences

Field Description
UTR seq + 25 agauauugaaagaugcugacaaguaguugguggugguaagagugaagaggaaaacuucuugcgATGGCAGCAGAGCCGCAGCCGTCCA
UTR dot + 25 …………..((((((…..))))))….((((((((……….))).)))))((((((.((……)).))))))..
RS 1 seq AGUUUGCAUAAAGAGAGGAAAUCCUCAGCAACCUAGAUUACCAACUAAGGUGCUUUUUGAUGUGGUUUAACGACAAAAAAUGGUAUUUU
RS 1 dot …………..((((….)))).((.((((((……..))).)))))((((((.(((……))).))))))……….
RS 2 seq UAGUUGCAUAAAGAGAAGGAAACUUCAGCAACCUAGUAGCCAACUAAGGUGCUUUUUGAUGUGGUUAAAUAACAAAAAAUGGCUUCUU
RS 2 dot …………..((((….)))).((.(((((((…..)))).)))))((((((.(((……))).))))))……….
RS 3 seq UAAAUGCAUAGAGAGAGGAAUACCUCAGCAACCUAGUAGCCAACUAAGGUGCUUUUUGAUGUGGUUAAACAACAAAAAUUGGCGUUC
RS 3 dot …………..((((….)))).((.(((((((…..)))).)))))((((((.(((……))).))))))………

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table