Detected as a riboswitch by 6 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA064134 Similarity: 0.973 Similarity: 0.972 Similarity: 0.972
UTR: 5HSAA064134
Gene: MBTD1
MFE: -20.265
ENS: 0.822
Length: 107.
Predicted Ligands:
SAM - 9/20
TPP - 4/20
glycine - 3/20
 RS: URS0000ABC1C1_701347
MFE: -33.460
Ligand: TPP
Species: Enterobacter cloacae SCF1 TPP riboswitch (THI element)
 RS: URS0000C0C9E0_435830
MFE: -48.733
Ligand: zmp-ztp
Species: Actinomyces graevenitzii C83 ZMP/ZTP riboswitch
 RS: URS0000D84B69_1121919
MFE: -31.747
Ligand: SAM
Species: Geosporobacter subterraneus DSM 17957 SAM riboswitch (S box leader)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA064134 URS0000ABC1C1_701347 URS0000C0C9E0_435830 URS0000D84B69_1121919
Length 107. 106. 107. 107.
Similarity - 0.973 0.972 0.972
Ensemble Norm 0.822 - - -
MFE -20.265 -33.460 -48.733 -31.747
Ligands - TPP zmp-ztp SAM
Gene MBTD1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 2.006 4.009 2.017
Length SE - 1. 0. 0.
Lev Distance - 34. 36. 37.
UBS 8. 8. 7. 8.
BS 0. 0. 0. 0.
ILL 1. 2. 2. 0.
ILR 2. 2. 2. 2.
H 3. 3. 3. 3.
BL 3. 2. 2. 3.
BR 2. 2. 1. 1.
UN 0.009 0.085 0.103 0.140

Sequences

Field Description
UTR seq + 25 gcagagggucccacgguggaagcgagagaggaggacugaacauucuucacgaucugaaaggaaaagaagagauucuuucgggATGTTTGACGGTTATGATAGCTGCA
UTR dot + 25 (.(((((((((..(……………)..)))))…..)))).)(((.((((((((((……….)))))))))).))).((.((((((…))))))))
RS 1 seq CCGUUCUCAACGGGGUGCUGCAGGCCAACGGCUAUGCGUGCUGAGAAGAUACCCGUCGAACCUGAUCCGGAUAACGCCGGCGAAGGGAUUUGAGGCUCACUCAAAA
RS 1 dot …(((((((((.(..((((……..))))..).)))..))))))….(((.(((……..((((……))))))).))).((((((…..)))))).
RS 2 seq UGUUAUCGCUGUAACUGGCGUGGGUGGGUCACCACCGGGGAGCGGCGAGCCCUUGAAACUUAAGUUUUAAGGGGUAAACCAUGGCGCCGCCCGCCUGGGUGCCUAGG
RS 2 dot …..(((((((..((.(.((((……..))))).))..))))))).((((((((((….))))))))))…..((..((((((………))))))..))
RS 3 seq CUCAUAUCCAGAGAGGUGGAGGGUCUGGCCCUAUGAAACCCGGCAACCGGCUUUUUAUUAAGCAGCGGUGCCAAUUCCUGCAGUAUGAAAAUACUGAGAGAUAUGAG
RS 3 dot .(((((.(((((………..)))))…)))))…..(((.((((((((……))))..)))))))…((((.((((((….)))))))).))……

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table